Mutagenetix > Incidental Mutation

Incidental Mutation 'R5082:Aox4'

500849

Institutional Source

Beutler Lab

Gene Symbol

Aox4

Ensembl Gene

ENSMUSG00000038242

Gene Name

aldehyde oxidase 4

Synonyms

2310003G12Rik, AOH2

MMRRC Submission

042671-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5082 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58210397-58268597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 58231483 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 274 (P274S)

Ref Sequence

ENSEMBL: ENSMUSP00000048929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040442]

AlphaFold

Q3TYQ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040442
AA Change: P274S

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: P274S

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.6e-10	PFAM
Pfam:Fer2_2	91	165	4.6e-30	PFAM
Pfam:FAD_binding_5	240	421	2.7e-47	PFAM
CO_deh_flav_C	428	532	1.19e-26	SMART
Ald_Xan_dh_C	596	699	8.22e-39	SMART
Pfam:Ald_Xan_dh_C2	709	1243	1.1e-178	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161833

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	A	11: 110,131,868	M1015L	probably benign	Het
Aftph	T	C	11: 20,727,100	S170G	probably damaging	Het
Ash1l	G	A	3: 88,966,234	R108Q	probably damaging	Het
Aspm	T	A	1: 139,478,676	L1767*	probably null	Het
Baz2b	T	A	2: 59,901,491	K2068*	probably null	Het
Bcl9	A	T	3: 97,209,902	V492D	probably damaging	Het
Bicc1	G	T	10: 70,940,522	H782Q	probably benign	Het
Cabin1	T	A	10: 75,738,330	I640F	probably damaging	Het
Ccng1	A	G	11: 40,752,188	V144A	possibly damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Ddx1	G	T	12: 13,220,435	C668*	probably null	Het
Dhx58	G	A	11: 100,696,976	S585L	probably benign	Het
Dnttip2	A	T	3: 122,275,941	K268N	probably damaging	Het
Ecd	C	T	14: 20,324,368		probably null	Het
Entpd1	A	G	19: 40,725,029		probably null	Het
Erlin2	T	C	8: 27,033,407	V224A	probably damaging	Het
Exoc3l4	A	G	12: 111,427,990	S515G	probably benign	Het
Fcho1	T	C	8: 71,717,185	D98G	possibly damaging	Het
Fhod1	T	A	8: 105,330,513	D943V	probably damaging	Het
Gm10322	A	T	10: 59,616,268	E69V	possibly damaging	Het
Gm14295	T	A	2: 176,807,417	L19*	probably null	Het
Gm7347	T	A	5: 26,057,374	R50*	probably null	Het
Hesx1	T	C	14: 27,000,774	C19R	probably benign	Het
Hgh1	T	A	15: 76,369,552	F199L	probably benign	Het
Irak2	T	C	6: 113,672,844	F147L	probably damaging	Het
Kif22	G	A	7: 127,033,377	R254C	possibly damaging	Het
Klhl9	A	T	4: 88,721,385	S206R	probably damaging	Het
Maip1	T	C	1: 57,411,851		probably null	Het
Mcm9	T	A	10: 53,538,060	E308V	possibly damaging	Het
Mfsd13b	A	T	7: 120,998,978	N369I	possibly damaging	Het
Mga	T	A	2: 119,903,344	H224Q	probably damaging	Het
Mtss1	A	T	15: 58,971,019	W115R	probably damaging	Het
Myo3b	T	C	2: 70,258,030	V851A	probably benign	Het
Nectin2	A	T	7: 19,738,124	D113E	probably damaging	Het
Notch2	G	A	3: 98,100,374	C480Y	probably damaging	Het
Olfr711	G	A	7: 106,971,664	R227C	probably benign	Het
Olfr922	T	C	9: 38,816,145	I214T	possibly damaging	Het
Pfdn1	G	T	18: 36,404,413	N111K	probably damaging	Het
Pfkl	A	T	10: 77,996,408	V283E	probably damaging	Het
Plbd2	G	T	5: 120,491,184	S305*	probably null	Het
Prom1	T	C	5: 44,000,832		probably null	Het
Ptbp2	T	A	3: 119,752,964	M90L	probably benign	Het
Rai1	G	A	11: 60,185,919	E270K	possibly damaging	Het
Rbbp6	G	A	7: 123,000,702		probably benign	Het
Reln	T	C	5: 21,896,077	M3399V	probably benign	Het
Ros1	T	A	10: 52,163,941	Y318F	possibly damaging	Het
Sh2d2a	A	G	3: 87,851,784	D231G	probably benign	Het
Smn1	T	C	13: 100,137,382		probably benign	Het
Snrnp200	C	T	2: 127,226,370	Q877*	probably null	Het
Taf2	G	T	15: 55,060,045	H279N	probably benign	Het
Tnfaip3	T	C	10: 19,005,284	Y345C	probably damaging	Het
Vmn2r68	C	T	7: 85,233,868	M225I	probably benign	Het
Vps13a	A	T	19: 16,744,893	W352R	probably damaging	Het

Other mutations in Aox4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Aox4	APN	1	58239174	missense	probably damaging	1.00
IGL01011:Aox4	APN	1	58240775	nonsense	probably null
IGL01634:Aox4	APN	1	58221930	missense	possibly damaging	0.81
IGL01689:Aox4	APN	1	58245161	splice site	probably benign
IGL01874:Aox4	APN	1	58252084	missense	probably damaging	1.00
IGL02104:Aox4	APN	1	58236657	splice site	probably benign
IGL02744:Aox4	APN	1	58255552	missense	possibly damaging	0.90
IGL02751:Aox4	APN	1	58259052	missense	probably damaging	1.00
IGL03225:Aox4	APN	1	58247227	missense	possibly damaging	0.94
IGL03247:Aox4	APN	1	58264367	missense	probably damaging	1.00
IGL03369:Aox4	APN	1	58262587	missense	probably benign	0.01
BB008:Aox4	UTSW	1	58255486	missense	probably benign	0.07
BB018:Aox4	UTSW	1	58255486	missense	probably benign	0.07
R0138:Aox4	UTSW	1	58228866	missense	probably damaging	1.00
R0243:Aox4	UTSW	1	58213076	missense	probably benign
R0368:Aox4	UTSW	1	58213079	missense	probably benign	0.07
R0499:Aox4	UTSW	1	58263397	critical splice donor site	probably null
R0513:Aox4	UTSW	1	58217519	missense	probably benign
R0513:Aox4	UTSW	1	58247300	missense	probably damaging	1.00
R0546:Aox4	UTSW	1	58250174	missense	probably damaging	1.00
R0591:Aox4	UTSW	1	58239102	splice site	probably benign
R0825:Aox4	UTSW	1	58248909	missense	possibly damaging	0.55
R1912:Aox4	UTSW	1	58264402	missense	probably damaging	1.00
R1934:Aox4	UTSW	1	58245936	missense	probably benign	0.01
R2180:Aox4	UTSW	1	58213067	missense	probably benign	0.00
R2293:Aox4	UTSW	1	58221937	missense	probably damaging	0.99
R3017:Aox4	UTSW	1	58235204	missense	probably benign
R3744:Aox4	UTSW	1	58245870	missense	probably damaging	1.00
R3745:Aox4	UTSW	1	58245870	missense	probably damaging	1.00
R3830:Aox4	UTSW	1	58255511	missense	probably damaging	0.99
R3856:Aox4	UTSW	1	58253934	missense	probably damaging	1.00
R4214:Aox4	UTSW	1	58221892	missense	probably damaging	0.99
R4484:Aox4	UTSW	1	58262571	missense	probably damaging	1.00
R4706:Aox4	UTSW	1	58266787	missense	probably damaging	1.00
R4710:Aox4	UTSW	1	58255638	missense	probably damaging	1.00
R4729:Aox4	UTSW	1	58259077	nonsense	probably null
R4769:Aox4	UTSW	1	58259148	missense	probably null	1.00
R4809:Aox4	UTSW	1	58266649	missense	probably damaging	1.00
R4989:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5102:Aox4	UTSW	1	58240778	missense	probably damaging	1.00
R5114:Aox4	UTSW	1	58246286	missense	possibly damaging	0.89
R5133:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5134:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5185:Aox4	UTSW	1	58254318	missense	probably damaging	1.00
R5217:Aox4	UTSW	1	58246241	nonsense	probably null
R5426:Aox4	UTSW	1	58220094	missense	probably damaging	1.00
R5443:Aox4	UTSW	1	58233992	splice site	probably null
R5708:Aox4	UTSW	1	58245873	missense	possibly damaging	0.69
R6052:Aox4	UTSW	1	58254318	nonsense	probably null
R6167:Aox4	UTSW	1	58263935	missense	probably damaging	1.00
R6179:Aox4	UTSW	1	58231503	missense	probably benign
R6196:Aox4	UTSW	1	58217526	missense	probably damaging	1.00
R6513:Aox4	UTSW	1	58213053	missense	probably benign	0.01
R6781:Aox4	UTSW	1	58245109	missense	probably benign	0.03
R6885:Aox4	UTSW	1	58264378	missense	probably damaging	1.00
R7082:Aox4	UTSW	1	58224193	missense	possibly damaging	0.82
R7127:Aox4	UTSW	1	58228874	missense	probably benign	0.00
R7153:Aox4	UTSW	1	58250219	missense	probably damaging	0.99
R7371:Aox4	UTSW	1	58263854	missense	probably damaging	1.00
R7690:Aox4	UTSW	1	58263917	missense	probably damaging	1.00
R7745:Aox4	UTSW	1	58240707	missense	probably benign	0.01
R7752:Aox4	UTSW	1	58253948	missense	not run
R7767:Aox4	UTSW	1	58235207	missense	probably damaging	0.98
R7782:Aox4	UTSW	1	58231092	splice site	probably null
R7931:Aox4	UTSW	1	58255486	missense	probably benign	0.07
R7978:Aox4	UTSW	1	58235207	missense	probably damaging	0.98
R7982:Aox4	UTSW	1	58257241	missense	possibly damaging	0.81
R8316:Aox4	UTSW	1	58254311	missense	possibly damaging	0.69
R8361:Aox4	UTSW	1	58240839	missense	probably benign	0.03
R8829:Aox4	UTSW	1	58255490	missense	probably benign	0.01
R8832:Aox4	UTSW	1	58255490	missense	probably benign	0.01
R8896:Aox4	UTSW	1	58252074	missense	probably benign
R9103:Aox4	UTSW	1	58257282	missense	probably damaging	1.00
R9241:Aox4	UTSW	1	58252186	missense	probably damaging	1.00
R9282:Aox4	UTSW	1	58245869	missense	possibly damaging	0.59
R9487:Aox4	UTSW	1	58248938	missense	probably benign	0.00
R9493:Aox4	UTSW	1	58247275	missense	probably benign	0.01
R9557:Aox4	UTSW	1	58245936	missense	probably benign	0.00
R9616:Aox4	UTSW	1	58228861	missense	possibly damaging	0.81
R9644:Aox4	UTSW	1	58228119	missense	probably benign	0.01
R9683:Aox4	UTSW	1	58239303	critical splice donor site	probably null
R9727:Aox4	UTSW	1	58247314	missense	probably benign	0.43
R9767:Aox4	UTSW	1	58235198	missense	probably benign	0.05
X0021:Aox4	UTSW	1	58247295	nonsense	probably null
X0028:Aox4	UTSW	1	58254183	missense	probably damaging	0.99
Z1176:Aox4	UTSW	1	58246351	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- AAACTCTTGGTGGGCACAGC -3'
(R):5'- CACAGCTGAGTGAGGTATTCTGAAG -3'

Sequencing Primer
(F):5'- GCACAGCTTGTTTCTATTCATGGGAC -3'
(R):5'- TAACCACGAAGTCACTGTGAATG -3'

Posted On

2017-12-01