Incidental Mutation 'R5083:Dhx36'
List |< first << previous [record 14 of 55] next >> last >|
ID500852
Institutional Source Beutler Lab
Gene Symbol Dhx36
Ensembl Gene ENSMUSG00000027770
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 36
Synonyms2810407E23Rik, Ddx36
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location62468013-62507004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62471999 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 889 (S889R)
Ref Sequence ENSEMBL: ENSMUSP00000029336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029336]
Predicted Effect probably benign
Transcript: ENSMUST00000029336
AA Change: S889R

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029336
Gene: ENSMUSG00000027770
AA Change: S889R

DomainStartEndE-ValueType
low complexity region 10 45 N/A INTRINSIC
DEXDc 198 389 1.53e-31 SMART
HELICc 495 600 5.61e-16 SMART
HA2 662 753 2.23e-26 SMART
Pfam:OB_NTP_bind 792 910 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160858
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality around E7.0. Mice homozygous for a conditional allele activated in the hematopoiesis systemexhibit impaired erythropoiesis associated with cell cycle defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Dhx36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dhx36 APN 3 62470558 utr 3 prime probably benign
IGL00538:Dhx36 APN 3 62501045 missense probably benign 0.04
IGL00706:Dhx36 APN 3 62496842 missense probably damaging 1.00
IGL02040:Dhx36 APN 3 62501015 missense probably benign
IGL02141:Dhx36 APN 3 62493889 missense probably benign 0.25
IGL02514:Dhx36 APN 3 62500898 missense possibly damaging 0.63
IGL02540:Dhx36 APN 3 62506888 missense probably benign 0.07
IGL02629:Dhx36 APN 3 62506734 missense probably benign 0.01
IGL02858:Dhx36 APN 3 62477376 splice site probably benign
IGL03305:Dhx36 APN 3 62500836 nonsense probably null
R0002:Dhx36 UTSW 3 62480839 missense probably damaging 1.00
R0002:Dhx36 UTSW 3 62480839 missense probably damaging 1.00
R0021:Dhx36 UTSW 3 62477595 missense possibly damaging 0.66
R0021:Dhx36 UTSW 3 62477595 missense possibly damaging 0.66
R0671:Dhx36 UTSW 3 62493741 missense possibly damaging 0.96
R0735:Dhx36 UTSW 3 62472729 missense probably benign 0.00
R0782:Dhx36 UTSW 3 62506714 splice site probably benign
R1725:Dhx36 UTSW 3 62506939 start codon destroyed probably benign 0.01
R1951:Dhx36 UTSW 3 62484273 missense probably damaging 0.99
R1959:Dhx36 UTSW 3 62479385 missense probably benign 0.01
R2257:Dhx36 UTSW 3 62477643 missense probably damaging 1.00
R2397:Dhx36 UTSW 3 62498097 missense probably benign 0.00
R2484:Dhx36 UTSW 3 62472815 missense probably damaging 0.96
R2973:Dhx36 UTSW 3 62495495 missense probably benign 0.00
R2973:Dhx36 UTSW 3 62495498 missense possibly damaging 0.56
R3617:Dhx36 UTSW 3 62472007 missense possibly damaging 0.96
R3617:Dhx36 UTSW 3 62487060 missense probably benign 0.01
R3725:Dhx36 UTSW 3 62488222 splice site probably benign
R3898:Dhx36 UTSW 3 62492369 missense probably damaging 0.98
R4332:Dhx36 UTSW 3 62484991 missense probably damaging 1.00
R4359:Dhx36 UTSW 3 62475278 missense probably benign 0.05
R4493:Dhx36 UTSW 3 62488504 intron probably benign
R4652:Dhx36 UTSW 3 62500998 missense probably benign 0.01
R4866:Dhx36 UTSW 3 62472777 missense probably damaging 1.00
R4884:Dhx36 UTSW 3 62484260 missense probably damaging 1.00
R4960:Dhx36 UTSW 3 62496859 missense probably damaging 1.00
R5162:Dhx36 UTSW 3 62493780 missense probably damaging 1.00
R5815:Dhx36 UTSW 3 62493755 missense probably damaging 1.00
R6090:Dhx36 UTSW 3 62496820 missense probably damaging 0.98
R6392:Dhx36 UTSW 3 62494369 missense probably benign 0.00
R6433:Dhx36 UTSW 3 62484974 missense probably damaging 1.00
R6504:Dhx36 UTSW 3 62488639 missense probably benign
R6615:Dhx36 UTSW 3 62488917 missense probably benign
R6672:Dhx36 UTSW 3 62495536 missense probably damaging 1.00
R6672:Dhx36 UTSW 3 62500879 missense probably benign 0.00
R7172:Dhx36 UTSW 3 62501015 missense probably benign
R7302:Dhx36 UTSW 3 62479393 missense probably benign
R7487:Dhx36 UTSW 3 62484202 missense possibly damaging 0.91
R7515:Dhx36 UTSW 3 62472087 missense probably benign 0.45
R7531:Dhx36 UTSW 3 62484968 missense probably damaging 1.00
R7579:Dhx36 UTSW 3 62480873 missense possibly damaging 0.64
R7726:Dhx36 UTSW 3 62488968 missense probably benign 0.01
R7874:Dhx36 UTSW 3 62488631 missense probably benign
R7957:Dhx36 UTSW 3 62488631 missense probably benign
R8056:Dhx36 UTSW 3 62488591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTGTCATGCCAACAAATCTTTAC -3'
(R):5'- TTTTGAAGTAACGAGGGAACAATCC -3'

Sequencing Primer
(F):5'- CCTGACAGCACTTTTTGAAAGCAG -3'
(R):5'- GGAACAATCCGTTGAGACACTTCTG -3'
Posted On2017-12-01