Mutagenetix > Incidental Mutation

Incidental Mutation 'R5069:Rnf17'

500870

Institutional Source

Beutler Lab

Gene Symbol

Rnf17

Ensembl Gene

ENSMUSG00000000365

Gene Name

ring finger protein 17

Synonyms

MMIP-2

MMRRC Submission

042659-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.644) question?

Stock #

R5069 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56402581-56525032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56505928 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1317 (V1317A)

Ref Sequence

ENSEMBL: ENSMUSP00000093469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095793]

AlphaFold

Q99MV7

Predicted Effect

probably damaging
Transcript: ENSMUST00000095793
AA Change: V1317A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: V1317A

Domain	Start	End	E-Value	Type
Blast:RING	9	72	2e-15	BLAST
low complexity region	398	405	N/A	INTRINSIC
Pfam:TUDOR	440	522	8.2e-8	PFAM
TUDOR	750	807	4.32e-12	SMART
low complexity region	824	836	N/A	INTRINSIC
Blast:TUDOR	850	882	1e-8	BLAST
low complexity region	959	970	N/A	INTRINSIC
TUDOR	984	1042	1.29e-1	SMART
low complexity region	1128	1139	N/A	INTRINSIC
TUDOR	1245	1301	7.7e-9	SMART
low complexity region	1416	1430	N/A	INTRINSIC
TUDOR	1495	1554	1e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000225737

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
9330182L06Rik	T	A	5: 9,440,897	C636S	probably damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
Adcy7	T	C	8: 88,327,697	L1060P	probably damaging	Het
Aff3	A	G	1: 38,181,613		probably null	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd27	A	T	7: 35,628,435	K793N	probably damaging	Het
Arhgef28	T	C	13: 98,075,206	T90A	probably damaging	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Ass1	C	T	2: 31,510,173	T301M	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
BC055324	T	C	1: 163,987,674	T93A	possibly damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cdh3	A	G	8: 106,536,826	N126S	probably benign	Het
Cfap54	A	C	10: 92,937,774	F135L	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm1043	T	G	5: 37,187,236	L231R	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gm14085	A	T	2: 122,494,373	N142I	possibly damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gpr153	T	A	4: 152,279,883	M132K	probably damaging	Het
Hbs1l	T	A	10: 21,354,647	S496T	probably damaging	Het
Inpp5f	A	G	7: 128,676,727		probably null	Het
Kat6a	G	A	8: 22,903,133	C209Y	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Krt75	A	G	15: 101,566,238		probably null	Het
Letm2	G	A	8: 25,593,964	Q84*	probably null	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Muc6	A	G	7: 141,651,299	C218R	probably damaging	Het
Myof	A	T	19: 37,905,325	I1130N	possibly damaging	Het
Neil3	A	G	8: 53,601,041	S318P	possibly damaging	Het
Nhlh1	A	G	1: 172,053,900	V133A	probably benign	Het
Nup153	A	C	13: 46,709,792	S331A	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pald1	A	T	10: 61,341,246	M675K	possibly damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pitpnm1	C	T	19: 4,111,140	A897V	probably benign	Het
Plxnd1	A	T	6: 115,965,901	V1274E	probably damaging	Het
Polr2a	T	C	11: 69,736,735		probably null	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rhbdl2	T	A	4: 123,817,917	L149*	probably null	Het
Rtel1	G	A	2: 181,355,492	V1042M	probably benign	Het
Sidt2	A	T	9: 45,939,461		probably null	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc4a10	G	A	2: 62,267,571	R508H	probably benign	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slf2	T	A	19: 44,935,253	S169T	possibly damaging	Het
Snx33	A	T	9: 56,926,191	I198N	probably damaging	Het
Spock3	A	G	8: 63,355,265	T396A	probably benign	Het
Sva	A	T	6: 42,038,417		probably benign	Het
Syt7	A	G	19: 10,439,237	N261S	probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Thoc2	C	T	X: 41,806,693	E1491K	probably damaging	Het
Tlr1	T	C	5: 64,926,400	Y278C	probably benign	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Trpm4	T	G	7: 45,310,469	Y667S	probably damaging	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Ube4a	T	C	9: 44,940,089	H709R	probably damaging	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wars2	A	G	3: 99,187,533	H48R	probably damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het

Other mutations in Rnf17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Rnf17	APN	14	56421082	missense	probably damaging	0.99
IGL00717:Rnf17	APN	14	56465750	missense	probably benign	0.00
IGL00978:Rnf17	APN	14	56512271	missense	probably damaging	1.00
IGL01295:Rnf17	APN	14	56463064	nonsense	probably null
IGL01779:Rnf17	APN	14	56462063	missense	probably benign	0.06
IGL02132:Rnf17	APN	14	56421166	missense	probably benign	0.27
IGL02183:Rnf17	APN	14	56507868	missense	probably null	0.99
IGL02387:Rnf17	APN	14	56500587	missense	probably damaging	1.00
IGL02422:Rnf17	APN	14	56482135	missense	probably damaging	1.00
IGL03081:Rnf17	APN	14	56434371	missense	probably benign	0.03
IGL03269:Rnf17	APN	14	56427946	missense	possibly damaging	0.74
divest	UTSW	14	56424542	frame shift	probably null
Shed	UTSW	14	56512296	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56471373	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56471373	missense	probably damaging	1.00
R0089:Rnf17	UTSW	14	56514106	missense	probably damaging	1.00
R0189:Rnf17	UTSW	14	56482193	missense	probably null	1.00
R0243:Rnf17	UTSW	14	56482084	missense	possibly damaging	0.80
R0245:Rnf17	UTSW	14	56438609	missense	probably damaging	0.97
R0486:Rnf17	UTSW	14	56514175	missense	probably benign	0.43
R0554:Rnf17	UTSW	14	56522550	missense	probably damaging	1.00
R0840:Rnf17	UTSW	14	56475447	missense	probably damaging	1.00
R1169:Rnf17	UTSW	14	56514165	missense	possibly damaging	0.89
R1170:Rnf17	UTSW	14	56425631	missense	probably benign	0.10
R1200:Rnf17	UTSW	14	56467706	missense	probably benign	0.44
R1464:Rnf17	UTSW	14	56461911	missense	probably damaging	1.00
R1464:Rnf17	UTSW	14	56461911	missense	probably damaging	1.00
R1472:Rnf17	UTSW	14	56427979	missense	probably damaging	1.00
R1512:Rnf17	UTSW	14	56467786	missense	probably benign	0.01
R1605:Rnf17	UTSW	14	56493365	missense	probably damaging	1.00
R1778:Rnf17	UTSW	14	56522399	missense	probably damaging	0.99
R1791:Rnf17	UTSW	14	56504007	nonsense	probably null
R2015:Rnf17	UTSW	14	56486969	missense	probably benign	0.00
R2023:Rnf17	UTSW	14	56431579	missense	possibly damaging	0.59
R2086:Rnf17	UTSW	14	56483380	missense	probably damaging	0.98
R2130:Rnf17	UTSW	14	56493354	missense	probably damaging	1.00
R2309:Rnf17	UTSW	14	56505982	missense	possibly damaging	0.95
R3003:Rnf17	UTSW	14	56500547	missense	probably damaging	1.00
R3611:Rnf17	UTSW	14	56467740	missense	probably benign	0.43
R3847:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3848:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3849:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3850:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3872:Rnf17	UTSW	14	56475413	missense	possibly damaging	0.89
R3874:Rnf17	UTSW	14	56475413	missense	possibly damaging	0.89
R4021:Rnf17	UTSW	14	56460001	missense	probably damaging	0.98
R4022:Rnf17	UTSW	14	56460001	missense	probably damaging	0.98
R4790:Rnf17	UTSW	14	56434355	missense	probably damaging	1.00
R4951:Rnf17	UTSW	14	56522391	missense	probably benign	0.02
R5068:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5070:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5518:Rnf17	UTSW	14	56482133	missense	probably damaging	1.00
R5628:Rnf17	UTSW	14	56486952	splice site	probably null
R5712:Rnf17	UTSW	14	56471399	missense	probably benign	0.19
R5747:Rnf17	UTSW	14	56465819	critical splice donor site	probably null
R5869:Rnf17	UTSW	14	56505988	missense	possibly damaging	0.94
R6336:Rnf17	UTSW	14	56421169	splice site	probably null
R6626:Rnf17	UTSW	14	56427924	missense	possibly damaging	0.92
R6639:Rnf17	UTSW	14	56438743	missense	probably benign	0.01
R6675:Rnf17	UTSW	14	56459975	missense	probably damaging	1.00
R6731:Rnf17	UTSW	14	56524350	missense	possibly damaging	0.93
R7062:Rnf17	UTSW	14	56465654	missense	probably benign	0.00
R7103:Rnf17	UTSW	14	56471306	missense	possibly damaging	0.63
R7144:Rnf17	UTSW	14	56512332	splice site	probably null
R7527:Rnf17	UTSW	14	56516438	missense	probably damaging	1.00
R7664:Rnf17	UTSW	14	56438878	missense	probably damaging	1.00
R7754:Rnf17	UTSW	14	56462072	critical splice donor site	probably null
R7772:Rnf17	UTSW	14	56477687	missense	probably benign	0.27
R8092:Rnf17	UTSW	14	56487022	missense	probably benign	0.00
R8150:Rnf17	UTSW	14	56421136	missense	probably benign	0.19
R8203:Rnf17	UTSW	14	56467722	missense	probably benign	0.17
R8320:Rnf17	UTSW	14	56424542	frame shift	probably null
R8321:Rnf17	UTSW	14	56424542	frame shift	probably null
R8379:Rnf17	UTSW	14	56424542	frame shift	probably null
R8380:Rnf17	UTSW	14	56424542	frame shift	probably null
R8381:Rnf17	UTSW	14	56424542	frame shift	probably null
R8382:Rnf17	UTSW	14	56424542	frame shift	probably null
R8383:Rnf17	UTSW	14	56424542	frame shift	probably null
R8799:Rnf17	UTSW	14	56500429	missense	probably damaging	1.00
R8850:Rnf17	UTSW	14	56485201	missense	probably damaging	1.00
R9212:Rnf17	UTSW	14	56524328	missense	probably damaging	1.00
R9276:Rnf17	UTSW	14	56482097	missense	probably damaging	1.00
R9300:Rnf17	UTSW	14	56460038	missense	possibly damaging	0.79
R9375:Rnf17	UTSW	14	56482122	missense	probably damaging	1.00
R9664:Rnf17	UTSW	14	56485179	missense	probably damaging	1.00
Z1177:Rnf17	UTSW	14	56467706	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- CAGCTGCTGAACCATCTCTCTAG -3'
(R):5'- ATTAGGCTTGCTCAAAACAGC -3'

Sequencing Primer
(F):5'- ATCTCTCTAGCCCCCAAGTAG -3'
(R):5'- GCTCAAAACAGCAATGTCTTATATG -3'

Posted On

2017-12-01