Mutagenetix > Incidental Mutations

Incidental Mutation 'R5102:Ddx50'

500878

Institutional Source

Beutler Lab

Gene Symbol

Ddx50

Ensembl Gene

ENSMUSG00000020076

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 50

Synonyms

GU2, RH-II/Gubeta, 8430408E17Rik, 4933429B04Rik

MMRRC Submission

042690-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R5102 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62615895-62651218 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62640861 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 211 (V211E)

Ref Sequence

ENSEMBL: ENSMUSP00000020270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020270]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020270
AA Change: V211E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020270
Gene: ENSMUSG00000020076
AA Change: V211E

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
low complexity region	58	65	N/A	INTRINSIC
Blast:DEXDc	66	104	3e-8	BLAST
low complexity region	105	122	N/A	INTRINSIC
DEXDc	153	354	1.97e-52	SMART
HELICc	398	480	1.8e-28	SMART
low complexity region	558	564	N/A	INTRINSIC
Pfam:GUCT	568	662	3.7e-31	PFAM
low complexity region	674	728	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219076

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810006K23Rik	A	G	5: 124,338,891	N83D	probably damaging	Het
Aox4	C	T	1: 58,240,778	R518C	probably damaging	Het
Apbb2	A	T	5: 66,312,249		probably null	Het
Arhgap45	C	T	10: 80,021,428	P254S	probably benign	Het
Arl4c	T	C	1: 88,701,600	D22G	probably damaging	Het
Asxl1	A	G	2: 153,400,955	T1142A	probably benign	Het
BC035044	T	C	6: 128,884,986		probably benign	Het
Bmp4	T	C	14: 46,384,001	N362S	probably damaging	Het
Cbll1	G	T	12: 31,487,913	T280N	probably damaging	Het
Cdh10	A	T	15: 18,986,885	T401S	probably benign	Het
Cps1	A	T	1: 67,206,793	M1148L	probably benign	Het
Crybg1	T	C	10: 43,997,836	D1092G	probably damaging	Het
Cyth2	A	G	7: 45,810,702	S173P	probably damaging	Het
D3Ertd254e	G	A	3: 36,162,665	C55Y	possibly damaging	Het
D6Ertd527e	A	T	6: 87,111,811	I319F	unknown	Het
Dchs1	A	T	7: 105,772,177	H345Q	probably benign	Het
Dlx6	AGG	AG	6: 6,865,180		probably null	Het
Dnajb5	G	A	4: 42,956,639	D109N	possibly damaging	Het
Dner	A	T	1: 84,405,970	N564K	probably damaging	Het
Fam234b	T	C	6: 135,209,284	S97P	probably benign	Het
Fam53b	G	A	7: 132,715,955	R60*	probably null	Het
Fmo3	T	G	1: 162,963,977	K244Q	probably benign	Het
Gm12800	T	C	4: 101,909,239	F40S	probably damaging	Het
Golim4	A	G	3: 75,903,272	I192T	possibly damaging	Het
Gpr1	A	G	1: 63,183,167	V303A	probably damaging	Het
Gprin1	T	C	13: 54,739,763	M233V	probably benign	Het
Gtf2f1	A	T	17: 57,003,626	V443D	probably damaging	Het
H2afy	C	G	13: 56,096,123		probably null	Het
Hmgcs2	T	C	3: 98,280,470		probably benign	Het
Ide	T	A	19: 37,314,984	I271L	unknown	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kif14	A	G	1: 136,516,403	I1378V	probably benign	Het
Lhx3	TCCTACGGGCCGGCCC	TCC	2: 26,201,423		probably null	Het
Lhx6	T	C	2: 36,094,210		probably null	Het
Lrp2	C	T	2: 69,489,158	G2007D	probably damaging	Het
Lrp5	T	C	19: 3,659,304	K142R	probably damaging	Het
Mrpl2	G	A	17: 46,650,038	R286Q	probably benign	Het
Nacad	T	A	11: 6,598,528	D1402V	probably damaging	Het
Ndfip2	T	C	14: 105,298,105	I275T	possibly damaging	Het
Neb	A	C	2: 52,226,570	V4131G	possibly damaging	Het
Nfe2l1	G	A	11: 96,822,108	A83V	probably damaging	Het
Nos3	A	G	5: 24,371,627	D418G	probably damaging	Het
Olfr1126	A	T	2: 87,457,794	M210L	probably benign	Het
Olfr353	T	A	2: 36,890,044	K268M	possibly damaging	Het
Plcd4	A	G	1: 74,565,154	T764A	probably damaging	Het
Plppr3	G	T	10: 79,865,386	P541T	possibly damaging	Het
Polr2a	A	G	11: 69,746,945	I191T	possibly damaging	Het
Rab11fip1	T	C	8: 27,156,374	K225E	probably damaging	Het
Rara	A	T	11: 98,966,359	Q64L	possibly damaging	Het
Rtkn	G	A	6: 83,149,773	V305M	probably damaging	Het
Sh2b1	A	C	7: 126,471,236	F399V	probably benign	Het
Slc7a4	T	C	16: 17,575,618	T106A	probably damaging	Het
Srcap	G	A	7: 127,530,623	G539D	probably damaging	Het
Stab1	C	T	14: 31,148,017		probably null	Het

Other mutations in Ddx50

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01517:Ddx50	APN	10	62647132	missense	probably benign
IGL01955:Ddx50	APN	10	62647183	missense	probably benign
IGL02677:Ddx50	APN	10	62616293	missense	unknown
IGL03169:Ddx50	APN	10	62621387	critical splice donor site	probably null
IGL03372:Ddx50	APN	10	62643330	missense	probably benign	0.11
K7371:Ddx50	UTSW	10	62621510	start codon destroyed	probably null
R0123:Ddx50	UTSW	10	62621377	splice site	probably benign
R0134:Ddx50	UTSW	10	62621377	splice site	probably benign
R0318:Ddx50	UTSW	10	62642837	missense	probably damaging	1.00
R0731:Ddx50	UTSW	10	62616249	missense	unknown
R1244:Ddx50	UTSW	10	62642924	missense	probably damaging	1.00
R1429:Ddx50	UTSW	10	62647068	missense	possibly damaging	0.45
R2005:Ddx50	UTSW	10	62640464	missense	probably benign	0.10
R2924:Ddx50	UTSW	10	62627594	missense	probably damaging	1.00
R3803:Ddx50	UTSW	10	62639944	missense	probably damaging	1.00
R3861:Ddx50	UTSW	10	62642946	missense	possibly damaging	0.91
R4169:Ddx50	UTSW	10	62640770	nonsense	probably null
R4917:Ddx50	UTSW	10	62627671	nonsense	probably null
R4918:Ddx50	UTSW	10	62627671	nonsense	probably null
R4951:Ddx50	UTSW	10	62634120	missense	probably damaging	0.99
R4962:Ddx50	UTSW	10	62642853	missense	probably damaging	1.00
R5403:Ddx50	UTSW	10	62647030	missense	probably benign
R5648:Ddx50	UTSW	10	62616270	missense	unknown
R5899:Ddx50	UTSW	10	62640817	nonsense	probably null
R6127:Ddx50	UTSW	10	62621563	splice site	probably null
R6244:Ddx50	UTSW	10	62621566	splice site	probably null
R8098:Ddx50	UTSW	10	62625143	critical splice donor site	probably null
R8163:Ddx50	UTSW	10	62639899	missense	possibly damaging	0.93
R8257:Ddx50	UTSW	10	62616520	splice site	probably benign
R8272:Ddx50	UTSW	10	62621477	missense	probably benign	0.05
R8356:Ddx50	UTSW	10	62621508	missense	probably benign	0.04
R8537:Ddx50	UTSW	10	62642849	missense	probably damaging	1.00
R8540:Ddx50	UTSW	10	62640790	missense	possibly damaging	0.94
R8759:Ddx50	UTSW	10	62616242	missense	unknown
X0026:Ddx50	UTSW	10	62625191	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTCTTTGATACGCCCTGG -3'
(R):5'- CCCAGGAAAGTGACTTTTGAAG -3'

Sequencing Primer
(F):5'- TGGGGTCCCAACAAGGATGTC -3'
(R):5'- ACCCAGTTTATGCATGCTAGG -3'

Posted On

2017-12-01