Incidental Mutation 'R5102:Ddx50'
ID500878
Institutional Source Beutler Lab
Gene Symbol Ddx50
Ensembl Gene ENSMUSG00000020076
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 50
SynonymsGU2, RH-II/Gubeta, 8430408E17Rik, 4933429B04Rik
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62615895-62651218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62640861 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 211 (V211E)
Ref Sequence ENSEMBL: ENSMUSP00000020270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020270]
Predicted Effect probably damaging
Transcript: ENSMUST00000020270
AA Change: V211E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020270
Gene: ENSMUSG00000020076
AA Change: V211E

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 58 65 N/A INTRINSIC
Blast:DEXDc 66 104 3e-8 BLAST
low complexity region 105 122 N/A INTRINSIC
DEXDc 153 354 1.97e-52 SMART
HELICc 398 480 1.8e-28 SMART
low complexity region 558 564 N/A INTRINSIC
Pfam:GUCT 568 662 3.7e-31 PFAM
low complexity region 674 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219076
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Ddx50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Ddx50 APN 10 62647132 missense probably benign
IGL01955:Ddx50 APN 10 62647183 missense probably benign
IGL02677:Ddx50 APN 10 62616293 missense unknown
IGL03169:Ddx50 APN 10 62621387 critical splice donor site probably null
IGL03372:Ddx50 APN 10 62643330 missense probably benign 0.11
K7371:Ddx50 UTSW 10 62621510 start codon destroyed probably null
R0123:Ddx50 UTSW 10 62621377 splice site probably benign
R0134:Ddx50 UTSW 10 62621377 splice site probably benign
R0318:Ddx50 UTSW 10 62642837 missense probably damaging 1.00
R0731:Ddx50 UTSW 10 62616249 missense unknown
R1244:Ddx50 UTSW 10 62642924 missense probably damaging 1.00
R1429:Ddx50 UTSW 10 62647068 missense possibly damaging 0.45
R2005:Ddx50 UTSW 10 62640464 missense probably benign 0.10
R2924:Ddx50 UTSW 10 62627594 missense probably damaging 1.00
R3803:Ddx50 UTSW 10 62639944 missense probably damaging 1.00
R3861:Ddx50 UTSW 10 62642946 missense possibly damaging 0.91
R4169:Ddx50 UTSW 10 62640770 nonsense probably null
R4917:Ddx50 UTSW 10 62627671 nonsense probably null
R4918:Ddx50 UTSW 10 62627671 nonsense probably null
R4951:Ddx50 UTSW 10 62634120 missense probably damaging 0.99
R4962:Ddx50 UTSW 10 62642853 missense probably damaging 1.00
R5403:Ddx50 UTSW 10 62647030 missense probably benign
R5648:Ddx50 UTSW 10 62616270 missense unknown
R5899:Ddx50 UTSW 10 62640817 nonsense probably null
R6127:Ddx50 UTSW 10 62621563 unclassified probably null
R6244:Ddx50 UTSW 10 62621566 unclassified probably null
X0026:Ddx50 UTSW 10 62625191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTTTGATACGCCCTGG -3'
(R):5'- CCCAGGAAAGTGACTTTTGAAG -3'

Sequencing Primer
(F):5'- TGGGGTCCCAACAAGGATGTC -3'
(R):5'- ACCCAGTTTATGCATGCTAGG -3'
Posted On2017-12-01