Incidental Mutation 'R5122:Cdc16'
ID500887
Institutional Source Beutler Lab
Gene Symbol Cdc16
Ensembl Gene ENSMUSG00000038416
Gene NameCDC16 cell division cycle 16
Synonyms2810431D22Rik, 2700071J12Rik
MMRRC Submission 042710-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5122 (G1)
Quality Score221
Status Not validated
Chromosome8
Chromosomal Location13757676-13781938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13764570 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 118 (Y118F)
Ref Sequence ENSEMBL: ENSMUSP00000147399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043962] [ENSMUST00000130173] [ENSMUST00000134645]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043962
AA Change: Y212F

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047950
Gene: ENSMUSG00000038416
AA Change: Y212F

DomainStartEndE-ValueType
Pfam:TPR_9 11 63 1.8e-3 PFAM
Pfam:ANAPC3 15 95 3.5e-23 PFAM
TPR 130 163 1.17e1 SMART
Blast:TPR 299 333 2e-8 BLAST
Blast:TPR 334 367 1e-14 BLAST
TPR 368 401 1.48e1 SMART
Blast:TPR 402 435 7e-15 BLAST
TPR 445 478 6.68e-6 SMART
TPR 479 512 1.74e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129872
Predicted Effect probably damaging
Transcript: ENSMUST00000130173
AA Change: Y118F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000134645
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,034,757 probably null Het
Acan T C 7: 79,100,661 S1727P probably damaging Het
Actr8 A T 14: 29,982,715 K57N possibly damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Bmp2k A G 5: 97,087,015 probably benign Het
Cd274 A G 19: 29,380,565 H219R possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Chchd3 T C 6: 32,968,305 R89G probably benign Het
Clstn2 C T 9: 97,461,421 V658M probably damaging Het
Cpt1b A G 15: 89,424,023 S160P probably benign Het
Crym T C 7: 120,195,495 N167S probably benign Het
Dhx16 T A 17: 35,883,310 Y438N probably damaging Het
Dnah12 A G 14: 26,718,000 R536G probably benign Het
Dnajc11 A G 4: 151,976,997 D382G possibly damaging Het
Dync1h1 G A 12: 110,629,680 G1547D probably damaging Het
Eml3 T A 19: 8,937,696 probably null Het
Ep400 G A 5: 110,668,170 P2799S probably damaging Het
Ephb6 T C 6: 41,613,404 V30A probably benign Het
Fam53b T A 7: 132,779,262 probably benign Het
Fcrl1 A G 3: 87,385,774 K246R probably benign Het
Focad G A 4: 88,407,365 probably null Het
Glipr1l2 T C 10: 112,107,056 I272T possibly damaging Het
Gm597 A G 1: 28,780,060 S47P probably benign Het
Gm8104 A G 14: 43,109,093 I101V probably benign Het
Grm5 A G 7: 88,074,820 I773V probably damaging Het
Hyal1 A T 9: 107,578,069 T193S probably benign Het
Igkv10-94 C A 6: 68,704,671 G62* probably null Het
Itsn1 A G 16: 91,893,844 probably benign Het
Kank4 A G 4: 98,756,567 S983P probably damaging Het
Krtap16-1 C A 11: 99,985,697 V294F probably damaging Het
Lama3 T G 18: 12,539,766 V866G possibly damaging Het
Lrba C T 3: 86,349,154 R1268* probably null Het
Lrriq1 C T 10: 103,187,453 V984I probably damaging Het
Macf1 A C 4: 123,452,292 V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 E419D probably damaging Het
Nedd4l A G 18: 65,191,447 Y473C probably damaging Het
Nod2 G T 8: 88,664,120 D330Y probably damaging Het
Nt5c2 C T 19: 46,889,921 C458Y probably damaging Het
Numa1 T C 7: 102,013,769 I681T probably damaging Het
Olfr713 C A 7: 107,036,848 S231* probably null Het
Papolg C T 11: 23,867,501 probably null Het
Parn A G 16: 13,654,447 probably null Het
Pgap2 T C 7: 102,231,391 F42S probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pofut2 G C 10: 77,268,565 R392P probably damaging Het
Prpf18 T C 2: 4,643,709 D102G probably damaging Het
Rreb1 T A 13: 37,930,768 I701N probably benign Het
Slc26a5 T C 5: 21,847,196 K45R probably damaging Het
Slc8a3 A G 12: 81,314,258 probably null Het
Slf1 T A 13: 77,049,987 M723L probably benign Het
Sra1 T C 18: 36,667,594 T187A probably benign Het
Stk17b A C 1: 53,776,558 N27K probably damaging Het
Tbc1d9 T A 8: 83,236,543 Y295N probably damaging Het
Tubgcp6 A G 15: 89,116,103 V353A probably damaging Het
Unc80 A T 1: 66,679,590 T2991S possibly damaging Het
Urb1 G A 16: 90,752,095 R2242* probably null Het
Vasp T C 7: 19,264,772 N20S probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Cdc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cdc16 APN 8 13767575 nonsense probably null
IGL01109:Cdc16 APN 8 13764606 missense probably benign 0.00
IGL01475:Cdc16 APN 8 13781542 missense probably benign
IGL02729:Cdc16 APN 8 13779250 missense possibly damaging 0.93
IGL03389:Cdc16 APN 8 13759179 missense probably damaging 1.00
R0026:Cdc16 UTSW 8 13759130 splice site probably null
R0373:Cdc16 UTSW 8 13779264 missense probably benign 0.04
R0520:Cdc16 UTSW 8 13760569 critical splice donor site probably null
R0564:Cdc16 UTSW 8 13781618 missense probably damaging 1.00
R1470:Cdc16 UTSW 8 13758992 splice site probably benign
R1487:Cdc16 UTSW 8 13771445 missense probably benign 0.17
R1753:Cdc16 UTSW 8 13764688 nonsense probably null
R1883:Cdc16 UTSW 8 13775738 missense probably damaging 1.00
R3087:Cdc16 UTSW 8 13759004 missense probably damaging 0.98
R3418:Cdc16 UTSW 8 13769489 nonsense probably null
R3756:Cdc16 UTSW 8 13777609 critical splice donor site probably null
R4152:Cdc16 UTSW 8 13762857 missense probably damaging 1.00
R4842:Cdc16 UTSW 8 13781644 utr 3 prime probably benign
R5492:Cdc16 UTSW 8 13763915 splice site probably null
R5982:Cdc16 UTSW 8 13781399 missense possibly damaging 0.73
R6145:Cdc16 UTSW 8 13767573 missense possibly damaging 0.96
R6154:Cdc16 UTSW 8 13768609 missense possibly damaging 0.87
R6611:Cdc16 UTSW 8 13781512 missense probably benign
R6992:Cdc16 UTSW 8 13759188 missense probably benign 0.22
R7011:Cdc16 UTSW 8 13769451 missense probably damaging 1.00
R7484:Cdc16 UTSW 8 13777605 missense probably benign 0.01
R7593:Cdc16 UTSW 8 13777605 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTCTGTCTTCTAAACGTGTATGTGAC -3'
(R):5'- TTAGACAGCACAGACCGAAGTG -3'

Sequencing Primer
(F):5'- GTGACATCCTTGTTACTATGGAAGTC -3'
(R):5'- AGACCGAAGTGCACATTCTG -3'
Posted On2017-12-01