Incidental Mutation 'R5045:Psd3'
ID500895
Institutional Source Beutler Lab
Gene Symbol Psd3
Ensembl Gene ENSMUSG00000030465
Gene Namepleckstrin and Sec7 domain containing 3
SynonymsEFA6D, 4931420C21Rik
MMRRC Submission 042635-MU
Accession Numbers

Ncbi RefSeq: NM_030263.5, NM_027626.1; MGI:1918215

Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location67689082-68212027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67713825 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 917 (E917G)
Ref Sequence ENSEMBL: ENSMUSP00000148401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038959] [ENSMUST00000059374] [ENSMUST00000093468] [ENSMUST00000093469] [ENSMUST00000098696] [ENSMUST00000120071] [ENSMUST00000212505] [ENSMUST00000212960]
Predicted Effect probably damaging
Transcript: ENSMUST00000038959
AA Change: E887G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041339
Gene: ENSMUSG00000030465
AA Change: E887G

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 693 3.9e-53 SMART
PH 743 857 3.85e-15 SMART
Blast:Sec7 876 938 2e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000059374
AA Change: E258G

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060306
Gene: ENSMUSG00000030465
AA Change: E258G

DomainStartEndE-ValueType
PH 114 228 3.85e-15 SMART
Blast:Sec7 247 305 1e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000093468
AA Change: E400G

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091178
Gene: ENSMUSG00000030465
AA Change: E400G

DomainStartEndE-ValueType
Sec7 17 206 1.35e-56 SMART
PH 256 370 3.85e-15 SMART
Blast:Sec7 389 451 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000093469
AA Change: E886G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091179
Gene: ENSMUSG00000030465
AA Change: E886G

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 692 2.4e-53 SMART
PH 742 856 3.85e-15 SMART
Blast:Sec7 875 937 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000098696
AA Change: E886G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096293
Gene: ENSMUSG00000030465
AA Change: E886G

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 692 2.4e-53 SMART
PH 742 856 3.85e-15 SMART
Blast:Sec7 875 937 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120071
AA Change: E258G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112545
Gene: ENSMUSG00000030465
AA Change: E258G

DomainStartEndE-ValueType
PH 114 228 3.85e-15 SMART
Blast:Sec7 247 309 3e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000212505
AA Change: E917G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212960
AA Change: E1171G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Psd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Psd3 APN 8 67908679 splice site probably benign
IGL01095:Psd3 APN 8 67908513 missense probably damaging 1.00
IGL01139:Psd3 APN 8 67908535 missense probably damaging 1.00
IGL01330:Psd3 APN 8 67697178 missense probably damaging 1.00
IGL01350:Psd3 APN 8 67720892 missense probably damaging 1.00
IGL01487:Psd3 APN 8 67697114 missense probably benign 0.01
IGL01780:Psd3 APN 8 67963869 missense probably benign
IGL02020:Psd3 APN 8 67974170 intron probably benign
IGL02232:Psd3 APN 8 67904145 missense probably damaging 1.00
IGL02350:Psd3 APN 8 67963869 missense probably benign
IGL02357:Psd3 APN 8 67963869 missense probably benign
PIT4495001:Psd3 UTSW 8 67963913 missense probably benign 0.00
R0052:Psd3 UTSW 8 67882979 critical splice donor site probably null
R0052:Psd3 UTSW 8 67882979 critical splice donor site probably null
R0242:Psd3 UTSW 8 67758086 missense probably damaging 0.99
R0242:Psd3 UTSW 8 67758086 missense probably damaging 0.99
R0581:Psd3 UTSW 8 67720946 missense probably damaging 1.00
R0655:Psd3 UTSW 8 67963689 missense probably benign 0.19
R1740:Psd3 UTSW 8 68120839 missense probably damaging 1.00
R1789:Psd3 UTSW 8 67960565 missense probably benign 0.26
R1847:Psd3 UTSW 8 67720004 missense possibly damaging 0.93
R1951:Psd3 UTSW 8 67963487 missense probably benign 0.00
R1954:Psd3 UTSW 8 67697075 missense probably damaging 1.00
R2143:Psd3 UTSW 8 67964351 missense probably damaging 1.00
R4387:Psd3 UTSW 8 68000761 missense probably damaging 1.00
R4801:Psd3 UTSW 8 68121148 missense probably benign
R4802:Psd3 UTSW 8 68121148 missense probably benign
R4913:Psd3 UTSW 8 68121169 missense probably damaging 0.99
R5173:Psd3 UTSW 8 67696989 missense probably damaging 1.00
R5264:Psd3 UTSW 8 67713725 missense probably benign 0.23
R5350:Psd3 UTSW 8 67908861 missense probably benign 0.00
R5816:Psd3 UTSW 8 67960510 missense possibly damaging 0.90
R5994:Psd3 UTSW 8 67719968 missense probably damaging 1.00
R6157:Psd3 UTSW 8 68121527 start codon destroyed probably benign 0.14
R6241:Psd3 UTSW 8 67818139 intron probably benign
R6586:Psd3 UTSW 8 67963545 missense probably damaging 0.96
R6735:Psd3 UTSW 8 68120746 critical splice donor site probably null
R6908:Psd3 UTSW 8 67964177 missense probably benign 0.00
R6984:Psd3 UTSW 8 67818045 missense possibly damaging 0.85
R7082:Psd3 UTSW 8 67904148 missense probably benign 0.03
R7116:Psd3 UTSW 8 67713738 missense probably benign 0.12
R7297:Psd3 UTSW 8 68121034 missense probably damaging 0.98
R7334:Psd3 UTSW 8 67908705 missense possibly damaging 0.94
R7348:Psd3 UTSW 8 67790931 missense possibly damaging 0.65
R7357:Psd3 UTSW 8 68121497 missense probably benign 0.01
R7369:Psd3 UTSW 8 67904166 missense possibly damaging 0.95
R7385:Psd3 UTSW 8 68000756 missense probably damaging 1.00
R7733:Psd3 UTSW 8 68120916 missense possibly damaging 0.75
R7873:Psd3 UTSW 8 67882982 missense possibly damaging 0.95
R7956:Psd3 UTSW 8 67882982 missense possibly damaging 0.95
Z1088:Psd3 UTSW 8 67906260 splice site silent
Predicted Primers PCR Primer
(F):5'- CTACCATGAGTGCTATGAGGTGTG -3'
(R):5'- GTTAGACCCTGTTGCCATCC -3'

Sequencing Primer
(F):5'- GCTATGAGGTGTGGACTTCAC -3'
(R):5'- TGGAAGGACTTAGGACCAA -3'
Posted On2017-12-01