Incidental Mutation 'R5045:Fam20a'
ID500897
Institutional Source Beutler Lab
Gene Symbol Fam20a
Ensembl Gene ENSMUSG00000020614
Gene Namefamily with sequence similarity 20, member A
Synonyms
MMRRC Submission 042635-MU
Accession Numbers

Ncbi RefSeq: NM_153782.1; MGI:2388266

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location109669749-109722279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109677885 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 272 (I272V)
Ref Sequence ENSEMBL: ENSMUSP00000116687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020938] [ENSMUST00000155559]
Predicted Effect probably benign
Transcript: ENSMUST00000020938
AA Change: I272V

PolyPhen 2 Score 0.384 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020938
Gene: ENSMUSG00000020614
AA Change: I272V

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:Fam20C 306 522 8.9e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146408
Predicted Effect probably benign
Transcript: ENSMUST00000155559
AA Change: I272V

PolyPhen 2 Score 0.384 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116687
Gene: ENSMUSG00000020614
AA Change: I272V

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:DUF1193 305 525 3.2e-103 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype Strain: 5432376
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ameloblast morphology, disrupted dental enamel formation in both incisor and molar teeth, abnormal kidney morphology, disseminated calcifications of muscular arteries, and intrapulmonary calcifications. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Fam20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Fam20a APN 11 109677762 splice site probably benign
IGL01296:Fam20a APN 11 109685351 missense possibly damaging 0.93
IGL01319:Fam20a APN 11 109678458 splice site probably benign
IGL01322:Fam20a APN 11 109682912 missense probably damaging 1.00
IGL02086:Fam20a APN 11 109673413 missense probably benign 0.00
IGL02563:Fam20a APN 11 109677794 missense possibly damaging 0.53
IGL02883:Fam20a APN 11 109675127 missense probably damaging 0.99
IGL02893:Fam20a APN 11 109721588 missense probably benign 0.00
ungainly UTSW 11 109682870 nonsense probably null
P0026:Fam20a UTSW 11 109675841 critical splice donor site probably null
R0726:Fam20a UTSW 11 109677194 missense probably damaging 1.00
R1317:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1462:Fam20a UTSW 11 109677317 missense probably damaging 1.00
R1462:Fam20a UTSW 11 109677317 missense probably damaging 1.00
R1751:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1761:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1889:Fam20a UTSW 11 109673554 missense probably benign 0.30
R1895:Fam20a UTSW 11 109673554 missense probably benign 0.30
R1971:Fam20a UTSW 11 109685411 missense probably damaging 1.00
R2192:Fam20a UTSW 11 109674623 missense probably benign 0.13
R3745:Fam20a UTSW 11 109677790 missense probably benign 0.17
R4684:Fam20a UTSW 11 109721687 missense unknown
R4835:Fam20a UTSW 11 109673563 missense probably benign 0.40
R5161:Fam20a UTSW 11 109673370 missense probably benign 0.00
R5715:Fam20a UTSW 11 109678431 missense probably damaging 1.00
R5817:Fam20a UTSW 11 109673418 missense possibly damaging 0.81
R5960:Fam20a UTSW 11 109675969 intron probably benign
R6162:Fam20a UTSW 11 109682870 nonsense probably null
R6312:Fam20a UTSW 11 109674630 missense probably damaging 1.00
R7231:Fam20a UTSW 11 109721375 missense possibly damaging 0.92
R7311:Fam20a UTSW 11 109674628 nonsense probably null
R7366:Fam20a UTSW 11 109673342 missense possibly damaging 0.87
R8013:Fam20a UTSW 11 109685506 missense not run
R8014:Fam20a UTSW 11 109685506 missense not run
Predicted Primers PCR Primer
(F):5'- ATGACGCATGTGCTAATGGC -3'
(R):5'- TGTTATGTTTCACCGAGGAGC -3'

Sequencing Primer
(F):5'- ACCTACCAGTGGGCATGATG -3'
(R):5'- AACTCATTCCATAGCTGGGGC -3'
Posted On2017-12-01