Mutagenetix > Incidental Mutation

Incidental Mutation 'R5302:Polr3b'

500901

Institutional Source

Beutler Lab

Gene Symbol

Polr3b

Ensembl Gene

ENSMUSG00000034453

Gene Name

polymerase (RNA) III (DNA directed) polypeptide B

Synonyms

RPC2, A330032P03Rik, 2700078H01Rik

MMRRC Submission

042885-MU

Accession Numbers

Genbank: NM_027423

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5302 (G1)

Quality Score

213

Status

Not validated

Chromosome

Chromosomal Location

84622292-84727178 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84699400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 858 (Y858H)

Ref Sequence

ENSEMBL: ENSMUSP00000076418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077175]

AlphaFold

P59470

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077175
AA Change: Y858H

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: Y858H

Domain	Start	End	E-Value	Type
Pfam:RNA_pol_Rpb2_1	38	413	2e-55	PFAM
Pfam:RNA_pol_Rpb2_2	185	363	8.4e-29	PFAM
Pfam:RNA_pol_Rpb2_3	438	502	2.6e-22	PFAM
Pfam:RNA_pol_Rpb2_4	539	600	1e-29	PFAM
Pfam:RNA_pol_Rpb2_5	621	661	6.5e-14	PFAM
Pfam:RNA_pol_Rpb2_6	668	1041	5.8e-129	PFAM
Pfam:RNA_pol_Rpb2_7	1043	1129	7.6e-36	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	G	1: 71,283,952	V1657A	possibly damaging	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Acot5	A	G	12: 84,073,441	Y190C	probably damaging	Het
Ascc3	T	A	10: 50,707,777	Y941N	probably benign	Het
BC035947	A	T	1: 78,511,962	M1K	probably null	Het
C2cd5	A	G	6: 143,073,756	C278R	probably benign	Het
Cd200r1	G	T	16: 44,792,809	L259F	possibly damaging	Het
Clcn4	A	G	7: 7,294,051	V136A	possibly damaging	Het
Cntnap5a	T	C	1: 116,157,570	S413P	probably benign	Het
Corin	T	A	5: 72,316,098	E748D	probably benign	Het
Crtc2	G	T	3: 90,261,018	G356V	probably damaging	Het
D1Pas1	T	A	1: 186,969,445	Y524N	probably damaging	Het
Dlgap4	T	C	2: 156,760,898	S147P	probably damaging	Het
Enpp1	A	T	10: 24,651,390	I633N	probably benign	Het
Gm3095	A	G	14: 3,964,498	D72G	probably null	Het
Gm5449	C	T	13: 53,525,751		noncoding transcript	Het
Gm6803	T	A	12: 88,018,546	I76F	probably damaging	Het
Gpx7	T	C	4: 108,400,914	T161A	probably benign	Het
Grip1	T	C	10: 120,020,077	L236P	probably damaging	Het
H2-Q2	G	T	17: 35,344,909	R255S	probably damaging	Het
Il17rc	G	T	6: 113,483,036	A648S	possibly damaging	Het
Klhl12	A	G	1: 134,489,451	E540G	possibly damaging	Het
Mcm10	T	C	2: 5,007,370	I135V	probably benign	Het
Mrps26	C	A	2: 130,564,167	T100K	probably benign	Het
Nid2	A	G	14: 19,779,701	T687A	probably benign	Het
Npas3	A	T	12: 54,068,836	D829V	probably damaging	Het
Ocln	T	C	13: 100,506,299	D176G	probably damaging	Het
Olfr745	A	G	14: 50,642,319		probably null	Het
Pax3	A	C	1: 78,121,612	M380R	possibly damaging	Het
Pcdha3	A	G	18: 36,948,155	E650G	probably damaging	Het
Pdcd11	C	A	19: 47,107,644	H668N	probably damaging	Het
Pus10	T	C	11: 23,667,416		probably null	Het
Raver1	T	C	9: 21,075,381	D739G	probably damaging	Het
Slc26a11	T	C	11: 119,363,450	L198P	probably damaging	Het
Slc44a3	A	G	3: 121,510,313	V258A	probably damaging	Het
Socs7	T	A	11: 97,389,199	I524N	probably damaging	Het
Steap4	T	A	5: 7,975,547	L36*	probably null	Het
Svep1	G	C	4: 58,096,183	T1479S	possibly damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Ttn	C	A	2: 76,717,275	V32184F	probably damaging	Het
Vmn1r22	T	C	6: 57,900,975	N6D	possibly damaging	Het

Other mutations in Polr3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00787:Polr3b	APN	10	84676990	missense	probably benign
IGL00848:Polr3b	APN	10	84680377	missense	probably damaging	1.00
IGL00901:Polr3b	APN	10	84631796	missense	possibly damaging	0.94
IGL01313:Polr3b	APN	10	84725743	missense	probably damaging	1.00
IGL01364:Polr3b	APN	10	84695669	missense	probably benign	0.00
IGL01731:Polr3b	APN	10	84631840	nonsense	probably null
IGL03326:Polr3b	APN	10	84667395	missense	probably benign	0.43
IGL03369:Polr3b	APN	10	84676952	missense	probably damaging	1.00
etruscan	UTSW	10	84632538	missense	probably benign	0.00
pennyweight	UTSW	10	84713632	missense	probably damaging	1.00
pinhead	UTSW	10	84655991	missense	probably damaging	1.00
G5538:Polr3b	UTSW	10	84631794	missense	probably benign	0.21
PIT4382001:Polr3b	UTSW	10	84684185	missense	probably damaging	1.00
R0180:Polr3b	UTSW	10	84622515	missense	probably benign
R0270:Polr3b	UTSW	10	84718475	missense	probably benign	0.02
R0541:Polr3b	UTSW	10	84638064	missense	probably damaging	1.00
R0890:Polr3b	UTSW	10	84714336	missense	probably benign	0.01
R1302:Polr3b	UTSW	10	84632486	missense	probably damaging	0.97
R1511:Polr3b	UTSW	10	84680385	missense	probably benign
R1561:Polr3b	UTSW	10	84634912	missense	probably damaging	1.00
R1607:Polr3b	UTSW	10	84652783	missense	probably benign	0.00
R1624:Polr3b	UTSW	10	84679805	missense	probably damaging	0.98
R1809:Polr3b	UTSW	10	84693001	missense	probably damaging	1.00
R1830:Polr3b	UTSW	10	84692922	nonsense	probably null
R2973:Polr3b	UTSW	10	84628280	missense	probably benign	0.00
R3401:Polr3b	UTSW	10	84699491	missense	probably damaging	0.96
R3876:Polr3b	UTSW	10	84720518	critical splice donor site	probably null
R3961:Polr3b	UTSW	10	84684302	missense	possibly damaging	0.89
R4664:Polr3b	UTSW	10	84714369	missense	probably damaging	1.00
R4721:Polr3b	UTSW	10	84656003	missense	possibly damaging	0.56
R4972:Polr3b	UTSW	10	84638124	missense	probably damaging	1.00
R5065:Polr3b	UTSW	10	84632538	missense	probably benign	0.00
R5264:Polr3b	UTSW	10	84667416	missense	probably benign	0.02
R5795:Polr3b	UTSW	10	84677011	missense	probably damaging	0.97
R5795:Polr3b	UTSW	10	84628252	missense	probably benign
R5838:Polr3b	UTSW	10	84674590	missense	probably benign	0.09
R6419:Polr3b	UTSW	10	84638111	missense	possibly damaging	0.78
R6568:Polr3b	UTSW	10	84634903	missense	probably damaging	1.00
R6787:Polr3b	UTSW	10	84628625	critical splice acceptor site	probably null
R6913:Polr3b	UTSW	10	84713632	missense	probably damaging	1.00
R7405:Polr3b	UTSW	10	84684179	missense	probably benign
R7456:Polr3b	UTSW	10	84622491	missense	probably benign
R7657:Polr3b	UTSW	10	84655991	missense	probably damaging	1.00
R8074:Polr3b	UTSW	10	84713659	missense	probably damaging	1.00
R8082:Polr3b	UTSW	10	84656063	missense	probably damaging	1.00
R8127:Polr3b	UTSW	10	84679789	missense	probably benign
R8676:Polr3b	UTSW	10	84680387	missense	probably benign	0.00
R8744:Polr3b	UTSW	10	84628624	splice site	probably benign
R8797:Polr3b	UTSW	10	84697015	nonsense	probably null
R8866:Polr3b	UTSW	10	84695691	missense	probably benign	0.14
R9006:Polr3b	UTSW	10	84631833	missense	probably benign	0.05
R9397:Polr3b	UTSW	10	84631789	missense	possibly damaging	0.93
R9509:Polr3b	UTSW	10	84631786	missense	probably damaging	1.00
X0066:Polr3b	UTSW	10	84713695	missense	probably damaging	0.97
Z1177:Polr3b	UTSW	10	84714293	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTCAGAGCATCGGTTAATGTTG -3'
(R):5'- GCTTGCAACACTTGGAGTTCC -3'

Sequencing Primer
(F):5'- CACTATGTCTGCCTCGTAATAAATG -3'
(R):5'- CACTCACCCTTTTGTCCATGG -3'

Posted On

2017-12-01