Incidental Mutation 'R5307:Nlrp4d'
ID 500903
Institutional Source Beutler Lab
Gene Symbol Nlrp4d
Ensembl Gene ENSMUSG00000034122
Gene Name NLR family, pyrin domain containing 4D
Synonyms Nalp4d, Nalp-beta
MMRRC Submission 042890-MU
Accession Numbers

Genbank: XM_001481310; Ensembl: ENSMUST00000184509

 

Essential gene? Non essential (E-score: 0.000) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 10358862-10388935 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 10362782 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 921 (G921*)
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182420
Predicted Effect probably null
Transcript: ENSMUST00000184509
AA Change: G921*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ap3d1 T C 10: 80,723,549 T264A probably benign Het
Arhgef17 C G 7: 100,929,428 G771A probably benign Het
Atg2b T A 12: 105,658,329 D637V probably benign Het
Atp10b A G 11: 43,212,475 E562G probably damaging Het
Atp1a1 A G 3: 101,589,964 V342A probably damaging Het
Atp2a2 A G 5: 122,461,747 I527T probably benign Het
Atr T A 9: 95,878,544 N1022K probably benign Het
Bach2 T A 4: 32,562,683 D383E probably benign Het
Casq1 A T 1: 172,219,416 L92Q probably damaging Het
Chd1 T A 17: 15,732,570 Y371N probably damaging Het
Chd9 G A 8: 90,997,149 A617T probably damaging Het
Cntrob T A 11: 69,314,750 R419S possibly damaging Het
Corin C A 5: 72,356,978 G318C probably damaging Het
Cpa3 A G 3: 20,227,163 probably null Het
Crybg1 T C 10: 44,003,714 S493G probably benign Het
Ddc A G 11: 11,876,321 F80S probably damaging Het
Dhrs2 A G 14: 55,236,144 S87G possibly damaging Het
Dnah12 A G 14: 26,693,486 E14G possibly damaging Het
Dtd1 A G 2: 144,747,022 E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 E895G probably damaging Het
Ehhadh A C 16: 21,762,692 S517A probably benign Het
Ephb2 C A 4: 136,693,787 Q417H possibly damaging Het
Ephb4 A G 5: 137,363,312 T526A probably damaging Het
Fam222b G A 11: 78,153,768 V52I probably damaging Het
Galm G A 17: 80,144,987 W118* probably null Het
Galm G T 17: 80,144,988 W118C probably damaging Het
Gcfc2 A G 6: 81,944,386 N458D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gykl1 A C 18: 52,694,651 R310S possibly damaging Het
Gzmn A C 14: 56,167,946 V27G probably damaging Het
H2-T23 T A 17: 36,032,216 M90L probably benign Het
Hnrnpu T C 1: 178,337,312 E87G unknown Het
Hps3 G A 3: 20,012,701 S567L possibly damaging Het
Igfn1 A T 1: 135,964,938 V2148E probably damaging Het
Ighv1-75 T C 12: 115,833,952 R117G probably damaging Het
Itgae C T 11: 73,145,638 A1134V probably benign Het
Kmt2b C T 7: 30,581,673 A1294T possibly damaging Het
Leng8 C T 7: 4,145,473 T748I probably damaging Het
Lrig3 G C 10: 126,006,690 D495H probably damaging Het
Mctp1 G A 13: 76,712,079 probably null Het
Mfsd3 T A 15: 76,702,171 L168* probably null Het
Nsun4 G A 4: 116,034,138 T348I probably damaging Het
Nucb1 T C 7: 45,498,418 T246A probably damaging Het
Nynrin A C 14: 55,863,806 S311R probably damaging Het
Olfr1019 T G 2: 85,841,014 Y259S probably damaging Het
Olfr1281 T A 2: 111,328,396 probably null Het
Ovch2 C A 7: 107,792,134 R303L probably benign Het
Pcsk9 A G 4: 106,447,174 S490P probably damaging Het
Pi4ka A G 16: 17,323,030 F859L probably benign Het
Pkd1l3 A G 8: 109,640,792 D1207G probably damaging Het
Pnpla7 G A 2: 25,021,952 R710Q possibly damaging Het
Prex2 T G 1: 11,200,032 S1314A probably damaging Het
Rnf216 A G 5: 143,093,002 L64P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a20b T G 9: 123,603,834 S374R possibly damaging Het
Slc8a1 G T 17: 81,649,224 N128K probably damaging Het
Slc9a3r1 T A 11: 115,163,761 I79N probably damaging Het
Slfn5 A T 11: 82,956,385 D32V probably damaging Het
Snrnp35 T C 5: 124,490,490 I122T possibly damaging Het
Snx24 C T 18: 53,340,211 Q76* probably null Het
Sspo T A 6: 48,454,850 H692Q probably damaging Het
Stxbp3 T C 3: 108,793,798 D585G probably damaging Het
Svep1 T C 4: 58,072,677 N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,028,424 probably null Het
Tnik T G 3: 28,541,972 D171E probably damaging Het
Ttc23l T A 15: 10,533,659 H266L probably damaging Het
Ttn G T 2: 76,894,770 S2037* probably null Het
Tuba3a G A 6: 125,281,310 T239I probably damaging Het
Usp25 T A 16: 77,093,706 D767E probably benign Het
Whrn G T 4: 63,431,843 H546N probably benign Het
Xirp2 C T 2: 67,511,162 T1249I probably damaging Het
Zbtb1 T A 12: 76,386,240 D333E probably damaging Het
Zfp689 T G 7: 127,448,815 E15A possibly damaging Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Nlrp4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Nlrp4d APN 7 10382094 exon noncoding transcript
IGL01076:Nlrp4d APN 7 10372083 missense unknown 0.00
IGL01656:Nlrp4d APN 7 10364147 missense noncoding transcript
IGL01889:Nlrp4d APN 7 10378334 missense unknown 0.00
IGL02110:Nlrp4d APN 7 10382564 exon noncoding transcript
IGL02271:Nlrp4d APN 7 10388698 exon noncoding transcript
IGL02637:Nlrp4d APN 7 10382555 exon noncoding transcript
snoop UTSW 7 10374891 missense probably benign 0.02
1mM(1):Nlrp4d UTSW 7 10381713 missense probably benign 0.09
F5493:Nlrp4d UTSW 7 10381084 missense possibly damaging 0.84
IGL03048:Nlrp4d UTSW 7 10358954 unclassified noncoding transcript
R0116:Nlrp4d UTSW 7 10374891 missense probably benign 0.02
R0125:Nlrp4d UTSW 7 10382389 missense probably damaging 1.00
R0390:Nlrp4d UTSW 7 10388778 missense probably benign 0.04
R0452:Nlrp4d UTSW 7 10378292 missense probably benign 0.01
R0595:Nlrp4d UTSW 7 10381045 missense probably benign 0.00
R0729:Nlrp4d UTSW 7 10377685 critical splice donor site probably benign
R0733:Nlrp4d UTSW 7 10382522 missense probably benign 0.02
R1147:Nlrp4d UTSW 7 10388717 missense probably benign 0.00
R1217:Nlrp4d UTSW 7 10364267 missense probably benign 0.36
R1378:Nlrp4d UTSW 7 10364184 missense probably benign 0.23
R1414:Nlrp4d UTSW 7 10382601 missense probably benign 0.22
R1583:Nlrp4d UTSW 7 10382237 missense probably damaging 0.99
R1585:Nlrp4d UTSW 7 10382510 missense probably benign 0.02
R1882:Nlrp4d UTSW 7 10382677 critical splice acceptor site noncoding transcript
R2422:Nlrp4d UTSW 7 10362945 missense probably benign 0.29
R2907:Nlrp4d UTSW 7 10378427 missense probably benign 0.00
R2964:Nlrp4d UTSW 7 10378329 nonsense probably null
R2974:Nlrp4d UTSW 7 10378440 critical splice acceptor site probably benign
R3401:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R3402:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R4240:Nlrp4d UTSW 7 10381316 missense noncoding transcript
R4682:Nlrp4d UTSW 7 10374952 missense noncoding transcript
R4766:Nlrp4d UTSW 7 10362779 critical splice donor site unknown
R4864:Nlrp4d UTSW 7 10381161 missense noncoding transcript
R4910:Nlrp4d UTSW 7 10378409 exon noncoding transcript
R5596:Nlrp4d UTSW 7 10382024 missense noncoding transcript
R5857:Nlrp4d UTSW 7 10382377 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATGGTGCTCCTTTCCCAAAC -3'
(R):5'- TTCACAGAGGCTATGGAGTGAG -3'

Sequencing Primer
(F):5'- AGATAGGGTCACTCATCTATCCTGG -3'
(R):5'- CTATGGAGTGAGCATAGTTTAATGAC -3'
Posted On 2017-12-01