Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Lrig3'

500904

Institutional Source

Beutler Lab

Gene Symbol

Lrig3

Ensembl Gene

ENSMUSG00000020105

Gene Name

leucine-rich repeats and immunoglobulin-like domains 3

Synonyms

9030421L11Rik, 9430095K15Rik, 9130004I02Rik

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125966168-126015359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 126006690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Histidine at position 495 (D495H)

Ref Sequence

ENSEMBL: ENSMUSP00000074360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074807]

AlphaFold

Q6P1C6

PDB Structure

Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074807
AA Change: D495H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: D495H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	46	78	6.74e-2	SMART
LRR	72	96	4.45e1	SMART
LRR	97	120	1.06e1	SMART
LRR	144	166	1.14e0	SMART
LRR	168	189	1.62e2	SMART
LRR	190	214	1.09e1	SMART
LRR	215	237	1.71e1	SMART
LRR	238	261	2.29e0	SMART
LRR	262	285	3.07e-1	SMART
LRR	286	309	2.49e-1	SMART
LRR	310	333	1.29e1	SMART
LRR	334	357	6.22e0	SMART
LRR	358	384	6.05e0	SMART
LRR_TYP	385	408	1.56e-2	SMART
LRR_TYP	409	432	1.79e-2	SMART
LRRCT	444	494	2.35e-7	SMART
IGc2	511	588	1.65e-4	SMART
IGc2	615	683	1.33e-8	SMART
IGc2	709	774	2.78e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220332

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Lrig3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lrig3	APN	10	126013148	missense	probably benign	0.00
IGL00426:Lrig3	APN	10	125972137	nonsense	probably null
IGL00969:Lrig3	APN	10	125997115	missense	probably damaging	1.00
IGL01376:Lrig3	APN	10	125994466	missense	probably benign	0.01
IGL01510:Lrig3	APN	10	126008698	missense	probably damaging	1.00
IGL01825:Lrig3	APN	10	126010017	missense	probably damaging	0.98
IGL02231:Lrig3	APN	10	125997172	missense	probably damaging	1.00
IGL02377:Lrig3	APN	10	126014874	missense	probably benign	0.00
IGL02648:Lrig3	APN	10	125966594	missense	probably benign
IGL02832:Lrig3	APN	10	126007002	missense	probably benign	0.37
IGL03266:Lrig3	APN	10	126013282	missense	probably benign	0.28
R0023:Lrig3	UTSW	10	126010219	missense	probably damaging	1.00
R0129:Lrig3	UTSW	10	126006943	missense	probably damaging	1.00
R0183:Lrig3	UTSW	10	126010192	missense	probably damaging	1.00
R0226:Lrig3	UTSW	10	125972117	splice site	probably benign
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0336:Lrig3	UTSW	10	125966705	missense	probably benign	0.04
R0348:Lrig3	UTSW	10	126013448	nonsense	probably null
R0502:Lrig3	UTSW	10	126008736	missense	probably damaging	1.00
R0639:Lrig3	UTSW	10	126010221	missense	probably damaging	1.00
R1099:Lrig3	UTSW	10	126007014	splice site	probably null
R1220:Lrig3	UTSW	10	125997076	missense	probably damaging	1.00
R1230:Lrig3	UTSW	10	126002971	missense	probably damaging	1.00
R1398:Lrig3	UTSW	10	126003088	missense	probably benign	0.00
R1451:Lrig3	UTSW	10	126010057	missense	possibly damaging	0.92
R1523:Lrig3	UTSW	10	126008698	missense	probably damaging	1.00
R1545:Lrig3	UTSW	10	126008547	missense	possibly damaging	0.80
R1661:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1665:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1673:Lrig3	UTSW	10	126010167	missense	probably damaging	1.00
R1778:Lrig3	UTSW	10	126010075	missense	probably damaging	1.00
R1800:Lrig3	UTSW	10	125997051	splice site	probably null
R1840:Lrig3	UTSW	10	126013389	nonsense	probably null
R1882:Lrig3	UTSW	10	126009825	missense	possibly damaging	0.89
R1900:Lrig3	UTSW	10	126002393	splice site	probably benign
R2160:Lrig3	UTSW	10	125997696	missense	possibly damaging	0.95
R2200:Lrig3	UTSW	10	125996609	splice site	probably null
R2294:Lrig3	UTSW	10	125966494	nonsense	probably null
R2518:Lrig3	UTSW	10	125994441	missense	probably benign	0.07
R3037:Lrig3	UTSW	10	126010032	missense	probably damaging	1.00
R3236:Lrig3	UTSW	10	125997187	missense	probably damaging	1.00
R4073:Lrig3	UTSW	10	126013408	missense	probably benign
R4074:Lrig3	UTSW	10	126013408	missense	probably benign
R4075:Lrig3	UTSW	10	126013408	missense	probably benign
R4077:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4079:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4405:Lrig3	UTSW	10	126011008	missense	probably benign	0.00
R4425:Lrig3	UTSW	10	126013404	missense	probably benign	0.00
R4505:Lrig3	UTSW	10	126013347	missense	probably benign	0.00
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4903:Lrig3	UTSW	10	125996613	critical splice acceptor site	probably null
R5201:Lrig3	UTSW	10	126013151	missense	possibly damaging	0.48
R5402:Lrig3	UTSW	10	126008740	missense	probably damaging	1.00
R5557:Lrig3	UTSW	10	125972134	missense	probably damaging	1.00
R5792:Lrig3	UTSW	10	126009919	missense	probably damaging	1.00
R5903:Lrig3	UTSW	10	126008478	missense	probably damaging	1.00
R6280:Lrig3	UTSW	10	126010979	missense	probably benign	0.18
R6484:Lrig3	UTSW	10	125996609	splice site	probably null
R6985:Lrig3	UTSW	10	126014869	missense	possibly damaging	0.64
R7089:Lrig3	UTSW	10	125997124	missense	probably damaging	1.00
R7177:Lrig3	UTSW	10	126006843	missense	probably benign	0.02
R7347:Lrig3	UTSW	10	126009966	missense	probably damaging	1.00
R9093:Lrig3	UTSW	10	126010081	missense	possibly damaging	0.51
R9188:Lrig3	UTSW	10	126003066	missense	possibly damaging	0.80
R9295:Lrig3	UTSW	10	126014853	missense	probably benign	0.00
R9378:Lrig3	UTSW	10	125997084	missense	probably damaging	0.98
R9526:Lrig3	UTSW	10	126014867	missense	probably benign
R9567:Lrig3	UTSW	10	126010095	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGGGTAACACTTCTCTCAGG -3'
(R):5'- GGTGTGCGTAGTTCTCCATC -3'

Sequencing Primer
(F):5'- ATAATGGTGGAACCGCTGTCC -3'
(R):5'- ATCTCTGCATCCTGAAGCG -3'

Posted On

2017-12-01