Incidental Mutation 'R5307:Lrig3'
ID 500904
Institutional Source Beutler Lab
Gene Symbol Lrig3
Ensembl Gene ENSMUSG00000020105
Gene Name leucine-rich repeats and immunoglobulin-like domains 3
Synonyms 9430095K15Rik, 9030421L11Rik, 9130004I02Rik
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.249) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 125802088-125851228 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 125842559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Histidine at position 495 (D495H)
Ref Sequence ENSEMBL: ENSMUSP00000074360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074807]
AlphaFold Q6P1C6
PDB Structure Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000074807
AA Change: D495H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: D495H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220332
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ap3d1 T C 10: 80,559,383 (GRCm39) T264A probably benign Het
Arhgef17 C G 7: 100,578,635 (GRCm39) G771A probably benign Het
Atg2b T A 12: 105,624,588 (GRCm39) D637V probably benign Het
Atp10b A G 11: 43,103,302 (GRCm39) E562G probably damaging Het
Atp1a1 A G 3: 101,497,280 (GRCm39) V342A probably damaging Het
Atp2a2 A G 5: 122,599,810 (GRCm39) I527T probably benign Het
Atr T A 9: 95,760,597 (GRCm39) N1022K probably benign Het
Bach2 T A 4: 32,562,683 (GRCm39) D383E probably benign Het
Casq1 A T 1: 172,046,983 (GRCm39) L92Q probably damaging Het
Chd1 T A 17: 15,952,832 (GRCm39) Y371N probably damaging Het
Chd9 G A 8: 91,723,777 (GRCm39) A617T probably damaging Het
Cntrob T A 11: 69,205,576 (GRCm39) R419S possibly damaging Het
Corin C A 5: 72,514,321 (GRCm39) G318C probably damaging Het
Cpa3 A G 3: 20,281,327 (GRCm39) probably null Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Crybg1 T C 10: 43,879,710 (GRCm39) S493G probably benign Het
Ddc A G 11: 11,826,321 (GRCm39) F80S probably damaging Het
Dhrs2 A G 14: 55,473,601 (GRCm39) S87G possibly damaging Het
Dnah12 A G 14: 26,414,641 (GRCm39) E14G possibly damaging Het
Dtd1 A G 2: 144,588,942 (GRCm39) E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 (GRCm39) E895G probably damaging Het
Ehhadh A C 16: 21,581,442 (GRCm39) S517A probably benign Het
Ephb2 C A 4: 136,421,098 (GRCm39) Q417H possibly damaging Het
Ephb4 A G 5: 137,361,574 (GRCm39) T526A probably damaging Het
Fam222b G A 11: 78,044,594 (GRCm39) V52I probably damaging Het
Galm G A 17: 80,452,416 (GRCm39) W118* probably null Het
Galm G T 17: 80,452,417 (GRCm39) W118C probably damaging Het
Gcfc2 A G 6: 81,921,367 (GRCm39) N458D probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gykl1 A C 18: 52,827,723 (GRCm39) R310S possibly damaging Het
Gzmn A C 14: 56,405,403 (GRCm39) V27G probably damaging Het
H2-T23 T A 17: 36,343,108 (GRCm39) M90L probably benign Het
Hnrnpu T C 1: 178,164,877 (GRCm39) E87G unknown Het
Hps3 G A 3: 20,066,865 (GRCm39) S567L possibly damaging Het
Igfn1 A T 1: 135,892,676 (GRCm39) V2148E probably damaging Het
Ighv1-75 T C 12: 115,797,572 (GRCm39) R117G probably damaging Het
Itgae C T 11: 73,036,464 (GRCm39) A1134V probably benign Het
Kmt2b C T 7: 30,281,098 (GRCm39) A1294T possibly damaging Het
Leng8 C T 7: 4,148,472 (GRCm39) T748I probably damaging Het
Mctp1 G A 13: 76,860,198 (GRCm39) probably null Het
Mfsd3 T A 15: 76,586,371 (GRCm39) L168* probably null Het
Nherf1 T A 11: 115,054,587 (GRCm39) I79N probably damaging Het
Nlrp4d C A 7: 10,096,709 (GRCm39) G921* probably null Het
Nsun4 G A 4: 115,891,335 (GRCm39) T348I probably damaging Het
Nucb1 T C 7: 45,147,842 (GRCm39) T246A probably damaging Het
Nynrin A C 14: 56,101,263 (GRCm39) S311R probably damaging Het
Or4k37 T A 2: 111,158,741 (GRCm39) probably null Het
Or5ar1 T G 2: 85,671,358 (GRCm39) Y259S probably damaging Het
Ovch2 C A 7: 107,391,341 (GRCm39) R303L probably benign Het
Pcsk9 A G 4: 106,304,371 (GRCm39) S490P probably damaging Het
Pi4ka A G 16: 17,140,894 (GRCm39) F859L probably benign Het
Pkd1l3 A G 8: 110,367,424 (GRCm39) D1207G probably damaging Het
Pnpla7 G A 2: 24,911,964 (GRCm39) R710Q possibly damaging Het
Prex2 T G 1: 11,270,256 (GRCm39) S1314A probably damaging Het
Rnf216 A G 5: 143,078,757 (GRCm39) L64P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc6a20b T G 9: 123,432,899 (GRCm39) S374R possibly damaging Het
Slc8a1 G T 17: 81,956,653 (GRCm39) N128K probably damaging Het
Slfn5 A T 11: 82,847,211 (GRCm39) D32V probably damaging Het
Snrnp35 T C 5: 124,628,553 (GRCm39) I122T possibly damaging Het
Snx24 C T 18: 53,473,283 (GRCm39) Q76* probably null Het
Sspo T A 6: 48,431,784 (GRCm39) H692Q probably damaging Het
Stxbp3 T C 3: 108,701,114 (GRCm39) D585G probably damaging Het
Svep1 T C 4: 58,072,677 (GRCm39) N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,112,881 (GRCm39) probably null Het
Tnik T G 3: 28,596,121 (GRCm39) D171E probably damaging Het
Ttc23l T A 15: 10,533,745 (GRCm39) H266L probably damaging Het
Ttn G T 2: 76,725,114 (GRCm39) S2037* probably null Het
Tuba3a G A 6: 125,258,273 (GRCm39) T239I probably damaging Het
Usp25 T A 16: 76,890,594 (GRCm39) D767E probably benign Het
Whrn G T 4: 63,350,080 (GRCm39) H546N probably benign Het
Xirp2 C T 2: 67,341,506 (GRCm39) T1249I probably damaging Het
Zbtb1 T A 12: 76,433,014 (GRCm39) D333E probably damaging Het
Zfp689 T G 7: 127,047,987 (GRCm39) E15A possibly damaging Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Lrig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrig3 APN 10 125,849,017 (GRCm39) missense probably benign 0.00
IGL00426:Lrig3 APN 10 125,808,006 (GRCm39) nonsense probably null
IGL00969:Lrig3 APN 10 125,832,984 (GRCm39) missense probably damaging 1.00
IGL01376:Lrig3 APN 10 125,830,335 (GRCm39) missense probably benign 0.01
IGL01510:Lrig3 APN 10 125,844,567 (GRCm39) missense probably damaging 1.00
IGL01825:Lrig3 APN 10 125,845,886 (GRCm39) missense probably damaging 0.98
IGL02231:Lrig3 APN 10 125,833,041 (GRCm39) missense probably damaging 1.00
IGL02377:Lrig3 APN 10 125,850,743 (GRCm39) missense probably benign 0.00
IGL02648:Lrig3 APN 10 125,802,463 (GRCm39) missense probably benign
IGL02832:Lrig3 APN 10 125,842,871 (GRCm39) missense probably benign 0.37
IGL03266:Lrig3 APN 10 125,849,151 (GRCm39) missense probably benign 0.28
R0023:Lrig3 UTSW 10 125,846,088 (GRCm39) missense probably damaging 1.00
R0129:Lrig3 UTSW 10 125,842,812 (GRCm39) missense probably damaging 1.00
R0183:Lrig3 UTSW 10 125,846,061 (GRCm39) missense probably damaging 1.00
R0226:Lrig3 UTSW 10 125,807,986 (GRCm39) splice site probably benign
R0233:Lrig3 UTSW 10 125,849,395 (GRCm39) splice site probably null
R0233:Lrig3 UTSW 10 125,849,395 (GRCm39) splice site probably null
R0336:Lrig3 UTSW 10 125,802,574 (GRCm39) missense probably benign 0.04
R0348:Lrig3 UTSW 10 125,849,317 (GRCm39) nonsense probably null
R0502:Lrig3 UTSW 10 125,844,605 (GRCm39) missense probably damaging 1.00
R0639:Lrig3 UTSW 10 125,846,090 (GRCm39) missense probably damaging 1.00
R1099:Lrig3 UTSW 10 125,842,883 (GRCm39) splice site probably null
R1220:Lrig3 UTSW 10 125,832,945 (GRCm39) missense probably damaging 1.00
R1230:Lrig3 UTSW 10 125,838,840 (GRCm39) missense probably damaging 1.00
R1398:Lrig3 UTSW 10 125,838,957 (GRCm39) missense probably benign 0.00
R1451:Lrig3 UTSW 10 125,845,926 (GRCm39) missense possibly damaging 0.92
R1523:Lrig3 UTSW 10 125,844,567 (GRCm39) missense probably damaging 1.00
R1545:Lrig3 UTSW 10 125,844,416 (GRCm39) missense possibly damaging 0.80
R1661:Lrig3 UTSW 10 125,833,570 (GRCm39) missense probably benign 0.12
R1665:Lrig3 UTSW 10 125,833,570 (GRCm39) missense probably benign 0.12
R1673:Lrig3 UTSW 10 125,846,036 (GRCm39) missense probably damaging 1.00
R1778:Lrig3 UTSW 10 125,845,944 (GRCm39) missense probably damaging 1.00
R1800:Lrig3 UTSW 10 125,832,920 (GRCm39) splice site probably null
R1840:Lrig3 UTSW 10 125,849,258 (GRCm39) nonsense probably null
R1882:Lrig3 UTSW 10 125,845,694 (GRCm39) missense possibly damaging 0.89
R1900:Lrig3 UTSW 10 125,838,262 (GRCm39) splice site probably benign
R2160:Lrig3 UTSW 10 125,833,565 (GRCm39) missense possibly damaging 0.95
R2200:Lrig3 UTSW 10 125,832,478 (GRCm39) splice site probably null
R2294:Lrig3 UTSW 10 125,802,363 (GRCm39) nonsense probably null
R2518:Lrig3 UTSW 10 125,830,310 (GRCm39) missense probably benign 0.07
R3037:Lrig3 UTSW 10 125,845,901 (GRCm39) missense probably damaging 1.00
R3236:Lrig3 UTSW 10 125,833,056 (GRCm39) missense probably damaging 1.00
R4073:Lrig3 UTSW 10 125,849,277 (GRCm39) missense probably benign
R4074:Lrig3 UTSW 10 125,849,277 (GRCm39) missense probably benign
R4075:Lrig3 UTSW 10 125,849,277 (GRCm39) missense probably benign
R4077:Lrig3 UTSW 10 125,845,656 (GRCm39) missense probably damaging 1.00
R4079:Lrig3 UTSW 10 125,845,656 (GRCm39) missense probably damaging 1.00
R4405:Lrig3 UTSW 10 125,846,877 (GRCm39) missense probably benign 0.00
R4425:Lrig3 UTSW 10 125,849,273 (GRCm39) missense probably benign 0.00
R4505:Lrig3 UTSW 10 125,849,216 (GRCm39) missense probably benign 0.00
R4860:Lrig3 UTSW 10 125,846,921 (GRCm39) missense probably benign 0.36
R4860:Lrig3 UTSW 10 125,846,921 (GRCm39) missense probably benign 0.36
R4903:Lrig3 UTSW 10 125,832,482 (GRCm39) critical splice acceptor site probably null
R5201:Lrig3 UTSW 10 125,849,020 (GRCm39) missense possibly damaging 0.48
R5402:Lrig3 UTSW 10 125,844,609 (GRCm39) missense probably damaging 1.00
R5557:Lrig3 UTSW 10 125,808,003 (GRCm39) missense probably damaging 1.00
R5792:Lrig3 UTSW 10 125,845,788 (GRCm39) missense probably damaging 1.00
R5903:Lrig3 UTSW 10 125,844,347 (GRCm39) missense probably damaging 1.00
R6280:Lrig3 UTSW 10 125,846,848 (GRCm39) missense probably benign 0.18
R6484:Lrig3 UTSW 10 125,832,478 (GRCm39) splice site probably null
R6985:Lrig3 UTSW 10 125,850,738 (GRCm39) missense possibly damaging 0.64
R7089:Lrig3 UTSW 10 125,832,993 (GRCm39) missense probably damaging 1.00
R7177:Lrig3 UTSW 10 125,842,712 (GRCm39) missense probably benign 0.02
R7347:Lrig3 UTSW 10 125,845,835 (GRCm39) missense probably damaging 1.00
R9093:Lrig3 UTSW 10 125,845,950 (GRCm39) missense possibly damaging 0.51
R9188:Lrig3 UTSW 10 125,838,935 (GRCm39) missense possibly damaging 0.80
R9295:Lrig3 UTSW 10 125,850,722 (GRCm39) missense probably benign 0.00
R9378:Lrig3 UTSW 10 125,832,953 (GRCm39) missense probably damaging 0.98
R9526:Lrig3 UTSW 10 125,850,736 (GRCm39) missense probably benign
R9567:Lrig3 UTSW 10 125,845,964 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGGTAACACTTCTCTCAGG -3'
(R):5'- GGTGTGCGTAGTTCTCCATC -3'

Sequencing Primer
(F):5'- ATAATGGTGGAACCGCTGTCC -3'
(R):5'- ATCTCTGCATCCTGAAGCG -3'
Posted On 2017-12-01