Mutagenetix > Incidental Mutation

Incidental Mutation 'R5324:Papln'

500911

Institutional Source

Beutler Lab

Gene Symbol

Papln

Ensembl Gene

ENSMUSG00000021223

Gene Name

papilin, proteoglycan-like sulfated glycoprotein

Synonyms

E030033C16Rik

MMRRC Submission

042907-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5324 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83763634-83792382 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 83774571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 226 (V226M)

Ref Sequence

ENSEMBL: ENSMUSP00000113806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000121733]

AlphaFold

Q9EPX2

Predicted Effect

probably damaging
Transcript: ENSMUST00000021646
AA Change: V226M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223
AA Change: V226M

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TSP1	30	81	3.36e-11	SMART
low complexity region	147	161	N/A	INTRINSIC
Pfam:ADAM_spacer1	184	299	3.3e-39	PFAM
TSP1	309	362	1.2e-7	SMART
TSP1	366	426	2.76e-7	SMART
TSP1	427	482	1.42e-9	SMART
TSP1	488	540	2.47e-9	SMART
low complexity region	604	621	N/A	INTRINSIC
KU	748	801	1.83e-22	SMART
low complexity region	822	831	N/A	INTRINSIC
IGc2	917	980	2.88e-4	SMART
IGc2	1056	1119	2.66e-17	SMART
IGc2	1145	1209	2.13e-7	SMART
Pfam:PLAC	1234	1268	2.3e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121733
AA Change: V226M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223
AA Change: V226M

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
TSP1	30	81	3.36e-11	SMART
low complexity region	147	161	N/A	INTRINSIC
Pfam:ADAM_spacer1	184	299	2.8e-38	PFAM
TSP1	309	362	1.2e-7	SMART
TSP1	388	448	1.82e-7	SMART
TSP1	449	504	1.42e-9	SMART
TSP1	510	562	2.47e-9	SMART
low complexity region	626	643	N/A	INTRINSIC
KU	770	823	1.83e-22	SMART
Pfam:Papilin_u7	831	922	1.9e-40	PFAM
IGc2	939	1002	2.88e-4	SMART
IGc2	1078	1141	2.66e-17	SMART
IGc2	1167	1231	2.13e-7	SMART
Pfam:PLAC	1257	1289	1.1e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152904

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	G	T	7: 127,384,907		probably benign	Het
Akap10	C	T	11: 61,916,189	A72T	probably damaging	Het
Ap5b1	G	A	19: 5,569,835	E428K	possibly damaging	Het
Bmp2	C	T	2: 133,561,359	R277*	probably null	Het
Cbl	A	T	9: 44,154,254	S659T	probably damaging	Het
Col14a1	A	T	15: 55,338,445	H43L	unknown	Het
Corin	A	G	5: 72,435,257	C133R	probably damaging	Het
Cyp1a1	A	G	9: 57,702,369	N401S	probably benign	Het
Dip2a	T	C	10: 76,296,393	D508G	probably damaging	Het
Dnah2	T	A	11: 69,457,993	H2556L	probably benign	Het
Dock8	T	C	19: 25,163,094	F1333L	probably benign	Het
Epg5	A	G	18: 77,962,445	K717E	possibly damaging	Het
Fmn2	G	A	1: 174,608,880		probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Hbp1	T	C	12: 31,928,618	N510S	probably damaging	Het
Lrguk	T	C	6: 34,073,797	S397P	possibly damaging	Het
Mmrn1	A	T	6: 60,976,586	D617V	probably damaging	Het
Mroh9	C	G	1: 163,060,760	G249R	probably damaging	Het
N6amt1	A	G	16: 87,354,353	D34G	probably damaging	Het
Nktr	A	T	9: 121,727,346	D30V	probably damaging	Het
Olfr1151	A	T	2: 87,857,696	I174F	probably damaging	Het
Olfr598	T	A	7: 103,329,050	M188K	probably damaging	Het
Olfr805	T	A	10: 129,722,945	I200L	probably benign	Het
Pabpc1	A	G	15: 36,600,625	F314L	probably damaging	Het
Parp12	A	T	6: 39,102,612	D321E	probably damaging	Het
Plch2	T	A	4: 154,984,534	T1107S	probably benign	Het
Psma2	T	C	13: 14,625,217	L182P	probably damaging	Het
Rcl1	A	G	19: 29,128,001	Y196C	probably benign	Het
Rdh16	G	A	10: 127,801,267	V24M	probably damaging	Het
Rpe65	A	G	3: 159,604,404	T105A	possibly damaging	Het
Serpini1	T	C	3: 75,640,294	I371T	probably damaging	Het
Tet2	T	C	3: 133,485,913	N920S	probably benign	Het
Tmem71	C	T	15: 66,555,214	S44N	probably benign	Het
Tmprss11f	T	A	5: 86,556,978	D27V	possibly damaging	Het
Zxdc	T	A	6: 90,373,800	I411N	probably damaging	Het

Other mutations in Papln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00824:Papln	APN	12	83770436	missense	possibly damaging	0.81
IGL01788:Papln	APN	12	83775462	missense	probably benign	0.32
IGL01889:Papln	APN	12	83786835	missense	probably benign	0.25
IGL02499:Papln	APN	12	83780671	missense	probably benign	0.00
IGL02567:Papln	APN	12	83778837	missense	probably benign	0.00
IGL03150:Papln	APN	12	83782984	missense	probably damaging	1.00
IGL03331:Papln	APN	12	83783661	missense	probably benign
F5770:Papln	UTSW	12	83778834	missense	possibly damaging	0.72
R0201:Papln	UTSW	12	83783027	splice site	probably benign
R0389:Papln	UTSW	12	83783379	nonsense	probably null
R0763:Papln	UTSW	12	83791865	missense	possibly damaging	0.54
R1508:Papln	UTSW	12	83782916	missense	probably damaging	0.99
R1628:Papln	UTSW	12	83784406	splice site	probably benign
R1920:Papln	UTSW	12	83789254	nonsense	probably null
R1974:Papln	UTSW	12	83782037	missense	probably damaging	0.98
R2004:Papln	UTSW	12	83773218	missense	probably damaging	1.00
R2105:Papln	UTSW	12	83780236	missense	probably benign	0.04
R2876:Papln	UTSW	12	83778927	missense	probably damaging	0.96
R4199:Papln	UTSW	12	83783392	missense	probably null	0.01
R4702:Papln	UTSW	12	83781983	missense	probably benign	0.01
R4705:Papln	UTSW	12	83777208	splice site	probably null
R4835:Papln	UTSW	12	83774420	missense	probably damaging	0.99
R4874:Papln	UTSW	12	83777143	missense	probably benign	0.01
R4938:Papln	UTSW	12	83782903	missense	probably benign	0.35
R5000:Papln	UTSW	12	83774889	missense	probably damaging	1.00
R5149:Papln	UTSW	12	83771882	splice site	probably null
R5784:Papln	UTSW	12	83781980	missense	probably benign
R5881:Papln	UTSW	12	83771878	missense	probably null	0.91
R5977:Papln	UTSW	12	83784369	nonsense	probably null
R6035:Papln	UTSW	12	83774680	missense	probably damaging	1.00
R6035:Papln	UTSW	12	83774680	missense	probably damaging	1.00
R6291:Papln	UTSW	12	83783015	missense	probably benign	0.01
R6461:Papln	UTSW	12	83781813	splice site	probably null
R6536:Papln	UTSW	12	83781887	missense	probably damaging	1.00
R6861:Papln	UTSW	12	83774949	missense	probably damaging	1.00
R6898:Papln	UTSW	12	83777460	missense	probably benign	0.03
R6953:Papln	UTSW	12	83781885	nonsense	probably null
R7155:Papln	UTSW	12	83776521	missense	probably damaging	1.00
R7450:Papln	UTSW	12	83780171	missense	probably benign	0.13
R7510:Papln	UTSW	12	83772173	missense	probably damaging	0.99
R7850:Papln	UTSW	12	83780662	missense	probably damaging	1.00
R7977:Papln	UTSW	12	83775382	missense	probably damaging	1.00
R7987:Papln	UTSW	12	83775382	missense	probably damaging	1.00
R8321:Papln	UTSW	12	83774941	nonsense	probably null
R8324:Papln	UTSW	12	83786619	missense	probably damaging	1.00
R8466:Papln	UTSW	12	83778481	critical splice acceptor site	probably null
R8743:Papln	UTSW	12	83782990	missense	probably damaging	1.00
R8790:Papln	UTSW	12	83777144	missense	probably benign	0.01
R9086:Papln	UTSW	12	83774859	missense	probably damaging	1.00
R9291:Papln	UTSW	12	83778510	missense	probably benign	0.01
R9350:Papln	UTSW	12	83786864	missense	probably damaging	1.00
R9438:Papln	UTSW	12	83771832	missense	probably benign
R9484:Papln	UTSW	12	83791844	missense	probably benign	0.05
V7580:Papln	UTSW	12	83778834	missense	possibly damaging	0.72
V7581:Papln	UTSW	12	83778834	missense	possibly damaging	0.72
V7582:Papln	UTSW	12	83778834	missense	possibly damaging	0.72
Z1088:Papln	UTSW	12	83776376	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- CTTGTTCCAATCAGGCTACAACC -3'
(R):5'- GAGTGTCGAGAGTGTCTTCAC -3'

Sequencing Primer
(F):5'- CAAATCTTCATCATTCCGGCTGGG -3'
(R):5'- GTGACCCACTCACCTCGATG -3'

Posted On

2017-12-01