Incidental Mutation 'R5192:Gstm1'
ID 500914
Institutional Source Beutler Lab
Gene Symbol Gstm1
Ensembl Gene ENSMUSG00000058135
Gene Name glutathione S-transferase, mu 1
Synonyms Gstb1, Gstb-1
MMRRC Submission 042768-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R5192 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 107919571-107925289 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 107922259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004140] [ENSMUST00000004140] [ENSMUST00000126593] [ENSMUST00000153314]
AlphaFold P10649
Predicted Effect probably null
Transcript: ENSMUST00000004140
SMART Domains Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135

DomainStartEndE-ValueType
Pfam:GST_N 3 82 1.3e-20 PFAM
Pfam:GST_C_3 40 190 5.2e-11 PFAM
Pfam:GST_C 104 192 3.7e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000004140
SMART Domains Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135

DomainStartEndE-ValueType
Pfam:GST_N 3 82 1.3e-20 PFAM
Pfam:GST_C_3 40 190 5.2e-11 PFAM
Pfam:GST_C 104 192 3.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120197
Predicted Effect probably null
Transcript: ENSMUST00000126593
SMART Domains Protein: ENSMUSP00000118874
Gene: ENSMUSG00000058135

DomainStartEndE-ValueType
Pfam:GST_N 3 82 8.3e-24 PFAM
Pfam:GST_C 104 201 6.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138374
Predicted Effect probably null
Transcript: ENSMUST00000153314
SMART Domains Protein: ENSMUSP00000123481
Gene: ENSMUSG00000058135

DomainStartEndE-ValueType
Pfam:GST_N 1 23 1.7e-7 PFAM
Pfam:GST_C 45 168 1.2e-18 PFAM
Pfam:GST_C_3 92 166 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198532
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for the deletion of this gene display a reduced ability to metabolize 1,2-dichloro-4-nitrobenzene. Mice homozygous for a different knock-out allele exhibit abnormal behavior, altered response to valproic acid, and increased serotonin and dopamine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef25 A G 10: 127,020,978 (GRCm39) S303P probably damaging Het
Babam1 T C 8: 71,856,897 (GRCm39) V286A probably damaging Het
Becn2 A G 1: 175,748,408 (GRCm39) D158G probably benign Het
Cep192 T C 18: 67,968,075 (GRCm39) I853T probably benign Het
Cfap43 A T 19: 47,814,364 (GRCm39) W157R probably damaging Het
Dnah17 T C 11: 117,925,185 (GRCm39) T3883A possibly damaging Het
Dzip1 C T 14: 119,148,805 (GRCm39) M291I probably damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fbxw19 T C 9: 109,313,496 (GRCm39) Y234C probably benign Het
Gask1a T G 9: 121,794,727 (GRCm39) S294A probably benign Het
Gm9988 T C 8: 88,865,001 (GRCm39) probably benign Het
Hsfy2 T A 1: 56,675,894 (GRCm39) K214N probably benign Het
Kat6a G A 8: 23,401,729 (GRCm39) R366H probably damaging Het
Kctd4 A G 14: 76,200,127 (GRCm39) T33A probably benign Het
Klrh1 T C 6: 129,748,721 (GRCm39) T99A probably benign Het
Marchf10 T C 11: 105,262,752 (GRCm39) H735R possibly damaging Het
Myo1g T C 11: 6,464,816 (GRCm39) D486G probably damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or5d46 A G 2: 88,170,092 (GRCm39) Y61C possibly damaging Het
Or8b1 T C 9: 38,400,101 (GRCm39) Y259H possibly damaging Het
Pif1 G T 9: 65,495,374 (GRCm39) A95S probably benign Het
Plppr2 T C 9: 21,852,428 (GRCm39) F104S probably damaging Het
Prep T C 10: 45,029,207 (GRCm39) Y536H probably benign Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Tmtc2 G A 10: 105,026,038 (GRCm39) P810L probably damaging Het
Tollip C T 7: 141,445,854 (GRCm39) R9H probably damaging Het
Vmn2r57 A T 7: 41,077,363 (GRCm39) S268T probably damaging Het
Vps51 A G 19: 6,120,497 (GRCm39) V472A possibly damaging Het
Zfp608 C A 18: 55,031,569 (GRCm39) K790N probably damaging Het
Zfp661 A G 2: 127,418,982 (GRCm39) V386A possibly damaging Het
Other mutations in Gstm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0335:Gstm1 UTSW 3 107,920,012 (GRCm39) missense possibly damaging 0.87
R0458:Gstm1 UTSW 3 107,924,679 (GRCm39) missense probably benign 0.01
R0907:Gstm1 UTSW 3 107,924,696 (GRCm39) missense probably damaging 1.00
R1069:Gstm1 UTSW 3 107,920,064 (GRCm39) missense probably damaging 1.00
R1180:Gstm1 UTSW 3 107,922,127 (GRCm39) missense probably damaging 1.00
R1181:Gstm1 UTSW 3 107,922,127 (GRCm39) missense probably damaging 1.00
R1998:Gstm1 UTSW 3 107,922,127 (GRCm39) missense probably damaging 1.00
R2000:Gstm1 UTSW 3 107,922,127 (GRCm39) missense probably damaging 1.00
R4483:Gstm1 UTSW 3 107,923,834 (GRCm39) critical splice donor site probably null
R4857:Gstm1 UTSW 3 107,923,724 (GRCm39) missense possibly damaging 0.67
R5262:Gstm1 UTSW 3 107,923,679 (GRCm39) missense probably benign 0.01
R5356:Gstm1 UTSW 3 107,920,052 (GRCm39) missense probably benign 0.00
R5485:Gstm1 UTSW 3 107,924,720 (GRCm39) missense probably damaging 1.00
R6323:Gstm1 UTSW 3 107,925,063 (GRCm39) missense probably benign 0.44
R7165:Gstm1 UTSW 3 107,923,693 (GRCm39) missense probably benign
R7250:Gstm1 UTSW 3 107,923,709 (GRCm39) missense probably damaging 0.98
R7638:Gstm1 UTSW 3 107,921,866 (GRCm39) splice site probably null
R9656:Gstm1 UTSW 3 107,925,072 (GRCm39) missense probably damaging 1.00
R9797:Gstm1 UTSW 3 107,925,080 (GRCm39) missense probably benign 0.10
X0023:Gstm1 UTSW 3 107,920,043 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGGGCATCACCTCGAAG -3'
(R):5'- ACCTGGCCCTTTCTTGGAAAG -3'

Sequencing Primer
(F):5'- ATCACCTCGAAGCGGGC -3'
(R):5'- CTTGGAAAGGTGGCTGTTCC -3'
Posted On 2017-12-01