Incidental Mutation 'R5292:Adam32'
ID500918
Institutional Source Beutler Lab
Gene Symbol Adam32
Ensembl Gene ENSMUSG00000037437
Gene Namea disintegrin and metallopeptidase domain 32
Synonyms
MMRRC Submission 042875-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5292 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location24836140-24948804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24864451 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 641 (V641A)
Ref Sequence ENSEMBL: ENSMUSP00000113627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119720] [ENSMUST00000121438] [ENSMUST00000173069] [ENSMUST00000173559]
Predicted Effect probably benign
Transcript: ENSMUST00000119720
SMART Domains Protein: ENSMUSP00000113076
Gene: ENSMUSG00000037437

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 145 4.5e-32 PFAM
Pfam:Reprolysin 187 384 4.1e-66 PFAM
Pfam:Reprolysin_3 211 318 6.2e-7 PFAM
DISIN 400 481 2.69e-16 SMART
ACR 482 622 6.83e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121438
AA Change: V641A

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113627
Gene: ENSMUSG00000037437
AA Change: V641A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 145 8.4e-26 PFAM
Pfam:Reprolysin 187 384 1.3e-68 PFAM
DISIN 400 481 2.69e-16 SMART
ACR 482 622 6.83e-38 SMART
EGF 631 660 1.73e0 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 719 754 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140573
SMART Domains Protein: ENSMUSP00000133843
Gene: ENSMUSG00000037437

DomainStartEndE-ValueType
Blast:DISIN 2 22 5e-7 BLAST
Pfam:ADAM_CR 24 71 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156719
Predicted Effect probably benign
Transcript: ENSMUST00000173069
SMART Domains Protein: ENSMUSP00000133631
Gene: ENSMUSG00000037437

DomainStartEndE-ValueType
Blast:ACR 1 46 7e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173559
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an metalloprotease, disintegrin and epidermal growth factor-like domains. This gene was found to be expressed predominantly in the pachytene spermatocytes, where the processed protein is localized to the sperm surface. This gene is located in a cluster of other disintegrin and metallopeptidase family genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T G 4: 57,855,356 S471R probably damaging Het
Apob A T 12: 8,005,912 M1465L probably benign Het
Astn1 T C 1: 158,580,363 probably null Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Col22a1 T C 15: 71,970,336 Y433C probably damaging Het
Crtc3 T C 7: 80,618,610 T154A possibly damaging Het
Dcc T C 18: 71,306,088 Y1241C probably damaging Het
Depdc1b T C 13: 108,373,842 V296A probably damaging Het
E430018J23Rik T C 7: 127,392,487 D97G possibly damaging Het
Gata3 A G 2: 9,868,874 S270P probably damaging Het
Gcm1 T C 9: 78,061,426 F136S probably damaging Het
Gfpt1 A G 6: 87,076,255 probably null Het
Gm5174 G T 10: 86,656,698 noncoding transcript Het
Hhipl1 A G 12: 108,327,778 T648A probably benign Het
Hr C A 14: 70,571,992 Q1177K probably damaging Het
Hrnr T C 3: 93,331,892 S3146P unknown Het
Igkv10-94 C T 6: 68,704,598 G86E probably damaging Het
Krt80 G A 15: 101,352,185 R222W probably damaging Het
Lrch3 T C 16: 32,975,807 Y354H probably damaging Het
Olfr1133 T A 2: 87,645,995 N43Y probably damaging Het
Olfr1510 A T 14: 52,410,445 N142K possibly damaging Het
Olfr401 T A 11: 74,122,051 F254Y probably damaging Het
Osbpl7 A G 11: 97,067,953 D932G probably benign Het
Palmd T C 3: 116,923,744 E368G probably benign Het
Peg3 T A 7: 6,708,260 D1321V probably damaging Het
Pkhd1l1 A T 15: 44,529,566 I1766F probably damaging Het
Polq A G 16: 37,061,383 E1303G probably damaging Het
Ppie A G 4: 123,139,908 Y9H probably damaging Het
Ptprz1 A G 6: 23,002,582 N1557S probably benign Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rtn4 T C 11: 29,707,924 F577L probably benign Het
Sacs A G 14: 61,211,983 Y3826C probably damaging Het
Slc32a1 A G 2: 158,611,387 D49G probably damaging Het
Slc37a2 A T 9: 37,239,157 C167* probably null Het
Slc5a1 G T 5: 33,158,241 V535F probably benign Het
Smoc2 A G 17: 14,336,573 K95E probably damaging Het
Smok3c A C 5: 138,065,184 Q311P probably damaging Het
Spink5 C A 18: 44,006,454 P628Q probably benign Het
Spint4 T C 2: 164,700,859 L124S probably benign Het
Stard9 A G 2: 120,699,145 K1961R probably benign Het
Synpo2 C A 3: 123,114,060 V536L possibly damaging Het
Trim24 A G 6: 37,903,604 K146E probably benign Het
Usp24 A G 4: 106,418,263 D2245G probably benign Het
Vars2 A G 17: 35,660,786 S81P probably damaging Het
Zfp39 T C 11: 58,900,589 T91A probably damaging Het
Zfp936 T A 7: 43,189,335 Y75* probably null Het
Zkscan5 G T 5: 145,218,641 C374F probably damaging Het
Other mutations in Adam32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Adam32 APN 8 24921354 missense probably damaging 1.00
IGL00793:Adam32 APN 8 24837830 splice site probably benign
IGL01317:Adam32 APN 8 24872581 missense probably damaging 1.00
IGL01475:Adam32 APN 8 24872648 missense probably damaging 1.00
IGL01501:Adam32 APN 8 24914353 missense probably damaging 1.00
IGL01659:Adam32 APN 8 24870774 splice site probably benign
IGL01994:Adam32 APN 8 24902796 splice site probably benign
IGL02137:Adam32 APN 8 24872594 missense probably damaging 1.00
IGL02393:Adam32 APN 8 24920053 missense probably damaging 1.00
IGL02516:Adam32 APN 8 24898596 missense probably damaging 1.00
IGL02892:Adam32 APN 8 24878711 intron probably benign
IGL02929:Adam32 APN 8 24872643 missense possibly damaging 0.81
IGL03273:Adam32 APN 8 24921340 missense probably damaging 1.00
PIT4515001:Adam32 UTSW 8 24914326 missense possibly damaging 0.88
R0088:Adam32 UTSW 8 24914067 missense probably damaging 1.00
R0098:Adam32 UTSW 8 24914389 missense possibly damaging 0.79
R0098:Adam32 UTSW 8 24914389 missense possibly damaging 0.79
R0189:Adam32 UTSW 8 24922337 critical splice acceptor site probably null
R1740:Adam32 UTSW 8 24921298 missense probably damaging 1.00
R1853:Adam32 UTSW 8 24898626 missense probably benign 0.02
R2090:Adam32 UTSW 8 24901440 critical splice donor site probably null
R2906:Adam32 UTSW 8 24863504 missense probably damaging 1.00
R2907:Adam32 UTSW 8 24863504 missense probably damaging 1.00
R4304:Adam32 UTSW 8 24901529 missense probably damaging 1.00
R4612:Adam32 UTSW 8 24872736 missense probably damaging 1.00
R4673:Adam32 UTSW 8 24884455 missense probably damaging 1.00
R4786:Adam32 UTSW 8 24863493 missense probably damaging 1.00
R5398:Adam32 UTSW 8 24872579 missense possibly damaging 0.95
R5524:Adam32 UTSW 8 24922312 missense probably damaging 0.99
R5939:Adam32 UTSW 8 24914122 missense probably damaging 1.00
R6350:Adam32 UTSW 8 24863429 missense possibly damaging 0.86
R6766:Adam32 UTSW 8 24872630 missense probably damaging 0.96
R6893:Adam32 UTSW 8 24878754 missense probably damaging 1.00
R7095:Adam32 UTSW 8 24914070 missense probably damaging 1.00
R7241:Adam32 UTSW 8 24898494 missense probably benign 0.00
R7457:Adam32 UTSW 8 24884619 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAGGTGGTAAAATGTGGC -3'
(R):5'- GGGCAAACATTTGAATTCACTACAG -3'

Sequencing Primer
(F):5'- GGCTTTCTTTGGATGAAAATAAGTG -3'
(R):5'- AAACATGTCTTCCTTTGATGTGTGAG -3'
Posted On2017-12-01