Incidental Mutation 'R5295:Lsm7'
ID500923
Institutional Source Beutler Lab
Gene Symbol Lsm7
Ensembl Gene ENSMUSG00000035215
Gene NameLSM7 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80852821-80855209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80854620 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 32 (E32G)
Ref Sequence ENSEMBL: ENSMUSP00000151340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000035775] [ENSMUST00000220091] [ENSMUST00000220225]
Predicted Effect probably benign
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035775
AA Change: E32G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044993
Gene: ENSMUSG00000035215
AA Change: E32G

DomainStartEndE-ValueType
Sm 13 86 3e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219421
Predicted Effect probably benign
Transcript: ENSMUST00000220091
Predicted Effect probably damaging
Transcript: ENSMUST00000220225
AA Change: E32G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220406
Meta Mutation Damage Score 0.6043 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Lsm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5244:Lsm7 UTSW 10 80853073 missense probably benign 0.00
R5275:Lsm7 UTSW 10 80854620 missense probably damaging 1.00
R6034:Lsm7 UTSW 10 80852908 utr 3 prime probably null
R6034:Lsm7 UTSW 10 80852908 utr 3 prime probably null
R7256:Lsm7 UTSW 10 80853731 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACTTGACTCCTTTCCTGGGG -3'
(R):5'- GCATTCAATTAGGCAGACACTG -3'

Sequencing Primer
(F):5'- GACTCCTTTCCTGGGGCTCTG -3'
(R):5'- CCTGAGTTGGAAAGGAGTCCCTG -3'
Posted On2017-12-01