Mutagenetix > Incidental Mutation

Incidental Mutation 'R5314:Kif1a'

500932

Institutional Source

Beutler Lab

Gene Symbol

Kif1a

Ensembl Gene

ENSMUSG00000014602

Gene Name

kinesin family member 1A

Synonyms

LOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1

MMRRC Submission

042897-MU

Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Essential gene?

Probably essential (E-score: 0.882) question?

Stock #

R5314 (G1)

Quality Score

202

Status

Not validated

Chromosome

Chromosomal Location

93015464-93101951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93018498 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1677 (S1677P)

Ref Sequence

ENSEMBL: ENSMUSP00000130717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000086819
AA Change: S1686P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: S1686P

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	411	429	N/A	INTRINSIC
FHA	524	581	1.39e-8	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	6.4e-13	PFAM
Pfam:DUF3694	1157	1305	1.8e-47	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112958
AA Change: S1686P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: S1686P

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	851	3.9e-15	PFAM
Pfam:DUF3694	1148	1304	5e-40	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171556
AA Change: S1677P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: S1677P

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	2.7e-13	PFAM
Pfam:DUF3694	1148	1296	8.4e-48	PFAM
low complexity region	1411	1435	N/A	INTRINSIC
low complexity region	1532	1540	N/A	INTRINSIC
PH	1575	1674	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171796
AA Change: S1685P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: S1685P

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	6.4e-13	PFAM
Pfam:DUF3694	1148	1304	1.8e-46	PFAM
low complexity region	1419	1443	N/A	INTRINSIC
low complexity region	1540	1548	N/A	INTRINSIC
PH	1583	1682	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188136

Predicted Effect

probably damaging
Transcript: ENSMUST00000190723
AA Change: S1779P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: S1779P

Domain	Start	End	E-Value	Type
KISc	3	362	5.2e-180	SMART
low complexity region	411	429	N/A	INTRINSIC
coiled coil region	438	471	N/A	INTRINSIC
FHA	524	581	6.9e-11	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	4e-10	PFAM
low complexity region	885	900	N/A	INTRINSIC
coiled coil region	901	929	N/A	INTRINSIC
internal_repeat_1	938	957	5.9e-5	PROSPERO
Pfam:DUF3694	1250	1398	1.1e-44	PFAM
low complexity region	1513	1537	N/A	INTRINSIC
low complexity region	1634	1642	N/A	INTRINSIC
PH	1677	1776	6.9e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190854

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432M17Rik	T	C	3: 121,679,523	F109S	unknown	Het
Ankhd1	A	T	18: 36,561,058		probably null	Het
Atp8a1	C	T	5: 67,705,905		probably null	Het
C77080	T	C	4: 129,224,212	T208A	possibly damaging	Het
Ccdc136	G	T	6: 29,417,498	V707F	probably benign	Het
Ccdc157	A	T	11: 4,150,078	C91*	probably null	Het
Ceacam3	T	A	7: 17,158,371	N346K	possibly damaging	Het
Chd4	A	G	6: 125,100,588	E74G	probably damaging	Het
Cntn1	A	G	15: 92,295,011	M665V	probably benign	Het
Crtc2	C	T	3: 90,261,041	Q364*	probably null	Het
Csf1r	T	A	18: 61,129,724	I857N	probably damaging	Het
Dner	C	T	1: 84,580,739	G168D	probably damaging	Het
Edar	T	C	10: 58,607,360	T315A	probably benign	Het
Egflam	A	G	15: 7,304,012	V153A	probably damaging	Het
Enoph1	T	C	5: 100,063,823	I193T	possibly damaging	Het
Epc1	A	G	18: 6,462,969	I9T	probably damaging	Het
Fbxw18	T	A	9: 109,693,178	I208F	possibly damaging	Het
Gm4841	A	G	18: 60,270,292	V243A	probably benign	Het
Herc2	T	C	7: 56,219,786	V4297A	probably damaging	Het
Itsn2	C	T	12: 4,627,960	P106S	probably benign	Het
Kcnu1	A	G	8: 25,862,458	T218A	probably damaging	Het
Krt14	A	T	11: 100,204,700	M293K	probably damaging	Het
Meis3	T	A	7: 16,184,064	V307E	probably damaging	Het
Nadk2	A	C	15: 9,108,313	I417L	probably benign	Het
Nav2	AAGCAGCAGCAGCAGCAGCAGCAGCA	AAGCAGCAGCAGCAGCAGCAGCA	7: 49,408,692		probably benign	Het
Neb	A	T	2: 52,281,503	N1659K	probably benign	Het
Olfr1490	T	C	19: 13,655,266	V274A	probably benign	Het
Olfr284	G	A	15: 98,340,365	A208V	probably benign	Het
Olfr951	T	C	9: 39,394,489	S233P	probably damaging	Het
Pde3b	A	T	7: 114,494,537	N339Y	probably damaging	Het
Pde8b	A	G	13: 95,086,853	F298L	possibly damaging	Het
Phtf1	G	A	3: 103,999,287	R606H	probably damaging	Het
Psd4	A	G	2: 24,400,516	D535G	possibly damaging	Het
Rad51ap1	A	G	6: 126,928,158	V130A	probably damaging	Het
Rbm11	T	C	16: 75,596,586	F57L	probably damaging	Het
Rprd2	A	G	3: 95,764,089	V1334A	possibly damaging	Het
Satb2	T	C	1: 56,831,527	E433G	probably damaging	Het
Sema6b	G	A	17: 56,128,413	R277*	probably null	Het
Sepsecs	A	T	5: 52,647,673	S349T	probably benign	Het
Slc35b2	T	C	17: 45,566,498	Y184H	probably damaging	Het
Slc7a2	T	C	8: 40,915,030		probably null	Het
Smc1b	T	A	15: 85,070,865	Y1062F	probably benign	Het
Snrnp70	G	A	7: 45,377,052	R298*	probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Taar8c	A	T	10: 24,101,348	C189S	probably damaging	Het
Tas1r2	T	A	4: 139,655,361	D103E	probably damaging	Het
Timd2	T	C	11: 46,677,260	I236V	probably benign	Het
Tmem87a	A	G	2: 120,377,926	V316A	probably damaging	Het
Treml2	T	A	17: 48,300,573	L16Q	probably damaging	Het
Wdr66	A	G	5: 123,322,563	D1196G	probably benign	Het
Zcchc14	G	A	8: 121,608,598		probably benign	Het
Zfp462	T	C	4: 55,013,178	Y567H	probably damaging	Het
Zfp551	G	A	7: 12,416,160	R441*	probably null	Het
Zfp930	A	G	8: 69,226,721	I59M	probably benign	Het

Other mutations in Kif1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kif1a	APN	1	93054934	missense	probably damaging	1.00
IGL01574:Kif1a	APN	1	93082340	missense	probably damaging	1.00
IGL01637:Kif1a	APN	1	93039853	missense	possibly damaging	0.95
IGL01895:Kif1a	APN	1	93025733	missense	possibly damaging	0.65
IGL02215:Kif1a	APN	1	93020549	missense	probably benign	0.05
IGL02571:Kif1a	APN	1	93020456	critical splice donor site	probably null
IGL02734:Kif1a	APN	1	93062558	missense	probably damaging	1.00
IGL02752:Kif1a	APN	1	93039847	missense	possibly damaging	0.92
IGL02990:Kif1a	APN	1	93039263	missense	probably damaging	1.00
IGL03298:Kif1a	APN	1	93066181	missense	probably damaging	1.00
IGL03309:Kif1a	APN	1	93058857	nonsense	probably null
IGL03354:Kif1a	APN	1	93060235	missense	probably damaging	1.00
asbestos	UTSW	1	93022505	missense	probably damaging	1.00
chrysolite	UTSW	1	93074948	splice site	probably benign
osmium	UTSW	1	93058810	splice site	probably benign
R4538_Kif1a_397	UTSW	1	93077047	missense	probably damaging	1.00
1mM(1):Kif1a	UTSW	1	93077068	missense	probably benign	0.00
IGL03046:Kif1a	UTSW	1	93082406	missense	probably damaging	1.00
PIT4508001:Kif1a	UTSW	1	93046729	missense	probably damaging	1.00
R0025:Kif1a	UTSW	1	93042358	missense	probably damaging	1.00
R0115:Kif1a	UTSW	1	93046778	splice site	probably benign
R0243:Kif1a	UTSW	1	93042093	missense	probably damaging	1.00
R0270:Kif1a	UTSW	1	93054442	splice site	probably benign
R0335:Kif1a	UTSW	1	93052566	splice site	probably benign
R0380:Kif1a	UTSW	1	93056031	critical splice acceptor site	probably null
R0472:Kif1a	UTSW	1	93018997	missense	probably damaging	0.99
R0501:Kif1a	UTSW	1	93056245	missense	probably damaging	1.00
R0538:Kif1a	UTSW	1	93043638	missense	probably damaging	0.99
R0628:Kif1a	UTSW	1	93019883	missense	probably damaging	1.00
R0848:Kif1a	UTSW	1	93019898	missense	probably damaging	1.00
R1110:Kif1a	UTSW	1	93023453	splice site	probably benign
R1132:Kif1a	UTSW	1	93056021	missense	probably damaging	0.99
R1387:Kif1a	UTSW	1	93055950	splice site	probably benign
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1544:Kif1a	UTSW	1	93074948	splice site	probably benign
R1569:Kif1a	UTSW	1	93058810	splice site	probably benign
R1802:Kif1a	UTSW	1	93066149	missense	probably damaging	1.00
R1917:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1919:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1999:Kif1a	UTSW	1	93060795	missense	probably damaging	0.98
R2000:Kif1a	UTSW	1	93054329	missense	probably damaging	0.99
R2276:Kif1a	UTSW	1	93068477	splice site	probably benign
R2307:Kif1a	UTSW	1	93078769	missense	probably damaging	1.00
R2919:Kif1a	UTSW	1	93046742	missense	probably damaging	1.00
R3440:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3441:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3618:Kif1a	UTSW	1	93077043	missense	probably null	1.00
R3957:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R4010:Kif1a	UTSW	1	93022409	missense	probably benign	0.42
R4013:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4017:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4115:Kif1a	UTSW	1	93052538	missense	probably damaging	1.00
R4386:Kif1a	UTSW	1	93068550	missense	probably damaging	1.00
R4538:Kif1a	UTSW	1	93077047	missense	probably damaging	1.00
R4608:Kif1a	UTSW	1	93024646	missense	possibly damaging	0.81
R4625:Kif1a	UTSW	1	93042659	missense	probably benign	0.00
R4701:Kif1a	UTSW	1	93078835	missense	probably damaging	0.99
R4794:Kif1a	UTSW	1	93025727	missense	probably damaging	1.00
R4830:Kif1a	UTSW	1	93021209	splice site	probably null
R4903:Kif1a	UTSW	1	93021734	missense	probably damaging	1.00
R4915:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4918:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4991:Kif1a	UTSW	1	93078808	missense	probably benign	0.00
R5028:Kif1a	UTSW	1	93054327	missense	possibly damaging	0.68
R5051:Kif1a	UTSW	1	93076154	splice site	probably null
R5073:Kif1a	UTSW	1	93022505	missense	probably damaging	1.00
R5103:Kif1a	UTSW	1	93046696	missense	probably damaging	1.00
R5481:Kif1a	UTSW	1	93060244	missense	probably benign	0.01
R5510:Kif1a	UTSW	1	93041692	missense	possibly damaging	0.93
R5610:Kif1a	UTSW	1	93025728	missense	probably damaging	1.00
R5643:Kif1a	UTSW	1	93055767	missense	probably damaging	0.98
R5808:Kif1a	UTSW	1	93042698	missense	probably damaging	0.99
R6027:Kif1a	UTSW	1	93025643	missense	probably benign	0.33
R6056:Kif1a	UTSW	1	93024648	missense	probably damaging	1.00
R6077:Kif1a	UTSW	1	93054896	missense	possibly damaging	0.54
R6120:Kif1a	UTSW	1	93024574	splice site	probably null
R6126:Kif1a	UTSW	1	93019899	missense	probably damaging	1.00
R6130:Kif1a	UTSW	1	93036901	missense	probably damaging	1.00
R6255:Kif1a	UTSW	1	93019983	missense	probably damaging	1.00
R6301:Kif1a	UTSW	1	93054941	nonsense	probably null
R6326:Kif1a	UTSW	1	93076326	missense	probably damaging	1.00
R6594:Kif1a	UTSW	1	93021313	missense	probably benign	0.00
R6653:Kif1a	UTSW	1	93077698	missense	probably damaging	1.00
R6791:Kif1a	UTSW	1	93066137	missense	probably damaging	1.00
R6853:Kif1a	UTSW	1	93039802	missense	possibly damaging	0.47
R7022:Kif1a	UTSW	1	93066098	missense	probably benign	0.31
R7059:Kif1a	UTSW	1	93046829	intron	probably benign
R7103:Kif1a	UTSW	1	93077785	missense	probably damaging	1.00
R7248:Kif1a	UTSW	1	93041583	missense	probably benign	0.35
R7259:Kif1a	UTSW	1	93073810	nonsense	probably null
R7424:Kif1a	UTSW	1	93054317	missense	possibly damaging	0.89
R7659:Kif1a	UTSW	1	93046820	intron	probably benign
R7681:Kif1a	UTSW	1	93054944	missense	probably benign
R7976:Kif1a	UTSW	1	93039774	missense	probably damaging	1.00
R8056:Kif1a	UTSW	1	93054701	intron	probably benign
R8420:Kif1a	UTSW	1	93022419	missense	probably benign
R8994:Kif1a	UTSW	1	93055735	missense	possibly damaging	0.77
R9016:Kif1a	UTSW	1	93025673	missense	probably damaging	1.00
R9206:Kif1a	UTSW	1	93051480	missense	probably damaging	0.99
R9246:Kif1a	UTSW	1	93077779	missense	probably damaging	0.98
R9252:Kif1a	UTSW	1	93075054	missense	probably damaging	1.00
R9388:Kif1a	UTSW	1	93072307	critical splice donor site	probably null
R9413:Kif1a	UTSW	1	93021297	missense	probably benign	0.00
R9612:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R9621:Kif1a	UTSW	1	93055723	missense	probably benign
R9625:Kif1a	UTSW	1	93073044	missense	probably benign	0.42
R9694:Kif1a	UTSW	1	93022451	missense	probably benign
Z1176:Kif1a	UTSW	1	93021316	missense	probably damaging	0.97
Z1176:Kif1a	UTSW	1	93022491	missense	probably damaging	1.00
Z1176:Kif1a	UTSW	1	93055697	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTCATGTGGTATAGGCCTCC -3'
(R):5'- GGCTTGATGAAGAGCCATGG -3'

Sequencing Primer
(F):5'- ATGTGGTATAGGCCTCCCTCCAG -3'
(R):5'- GCTGAGGTGCCACCCAAAAG -3'

Posted On

2017-12-01