Incidental Mutation 'R5314:Rad51ap1'
ID500934
Institutional Source Beutler Lab
Gene Symbol Rad51ap1
Ensembl Gene ENSMUSG00000030346
Gene NameRAD51 associated protein 1
SynonymsRAB22, 2510006L10Rik
MMRRC Submission 042897-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5314 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location126923050-126939587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126928158 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 130 (V130A)
Ref Sequence ENSEMBL: ENSMUSP00000107839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112220] [ENSMUST00000112221] [ENSMUST00000144954] [ENSMUST00000202897]
Predicted Effect probably damaging
Transcript: ENSMUST00000112220
AA Change: V130A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107839
Gene: ENSMUSG00000030346
AA Change: V130A

DomainStartEndE-ValueType
low complexity region 179 204 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112221
AA Change: V130A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107841
Gene: ENSMUSG00000030346
AA Change: V130A

DomainStartEndE-ValueType
low complexity region 180 205 N/A INTRINSIC
low complexity region 212 222 N/A INTRINSIC
Pfam:RAD51_interact 293 331 1.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141212
Predicted Effect probably benign
Transcript: ENSMUST00000144954
AA Change: V71A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122978
Gene: ENSMUSG00000030346
AA Change: V71A

DomainStartEndE-ValueType
low complexity region 121 146 N/A INTRINSIC
low complexity region 153 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202835
Predicted Effect probably benign
Transcript: ENSMUST00000202897
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik T C 3: 121,679,523 F109S unknown Het
Ankhd1 A T 18: 36,561,058 probably null Het
Atp8a1 C T 5: 67,705,905 probably null Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc136 G T 6: 29,417,498 V707F probably benign Het
Ccdc157 A T 11: 4,150,078 C91* probably null Het
Ceacam3 T A 7: 17,158,371 N346K possibly damaging Het
Chd4 A G 6: 125,100,588 E74G probably damaging Het
Cntn1 A G 15: 92,295,011 M665V probably benign Het
Crtc2 C T 3: 90,261,041 Q364* probably null Het
Csf1r T A 18: 61,129,724 I857N probably damaging Het
Dner C T 1: 84,580,739 G168D probably damaging Het
Edar T C 10: 58,607,360 T315A probably benign Het
Egflam A G 15: 7,304,012 V153A probably damaging Het
Enoph1 T C 5: 100,063,823 I193T possibly damaging Het
Epc1 A G 18: 6,462,969 I9T probably damaging Het
Fbxw18 T A 9: 109,693,178 I208F possibly damaging Het
Gm4841 A G 18: 60,270,292 V243A probably benign Het
Herc2 T C 7: 56,219,786 V4297A probably damaging Het
Itsn2 C T 12: 4,627,960 P106S probably benign Het
Kcnu1 A G 8: 25,862,458 T218A probably damaging Het
Kif1a A G 1: 93,018,498 S1677P probably damaging Het
Krt14 A T 11: 100,204,700 M293K probably damaging Het
Meis3 T A 7: 16,184,064 V307E probably damaging Het
Nadk2 A C 15: 9,108,313 I417L probably benign Het
Nav2 AAGCAGCAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCAGCAGCA 7: 49,408,692 probably benign Het
Neb A T 2: 52,281,503 N1659K probably benign Het
Olfr1490 T C 19: 13,655,266 V274A probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr951 T C 9: 39,394,489 S233P probably damaging Het
Pde3b A T 7: 114,494,537 N339Y probably damaging Het
Pde8b A G 13: 95,086,853 F298L possibly damaging Het
Phtf1 G A 3: 103,999,287 R606H probably damaging Het
Psd4 A G 2: 24,400,516 D535G possibly damaging Het
Rbm11 T C 16: 75,596,586 F57L probably damaging Het
Rprd2 A G 3: 95,764,089 V1334A possibly damaging Het
Satb2 T C 1: 56,831,527 E433G probably damaging Het
Sema6b G A 17: 56,128,413 R277* probably null Het
Sepsecs A T 5: 52,647,673 S349T probably benign Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Slc7a2 T C 8: 40,915,030 probably null Het
Smc1b T A 15: 85,070,865 Y1062F probably benign Het
Snrnp70 G A 7: 45,377,052 R298* probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Taar8c A T 10: 24,101,348 C189S probably damaging Het
Tas1r2 T A 4: 139,655,361 D103E probably damaging Het
Timd2 T C 11: 46,677,260 I236V probably benign Het
Tmem87a A G 2: 120,377,926 V316A probably damaging Het
Treml2 T A 17: 48,300,573 L16Q probably damaging Het
Wdr66 A G 5: 123,322,563 D1196G probably benign Het
Zcchc14 G A 8: 121,608,598 probably benign Het
Zfp462 T C 4: 55,013,178 Y567H probably damaging Het
Zfp551 G A 7: 12,416,160 R441* probably null Het
Zfp930 A G 8: 69,226,721 I59M probably benign Het
Other mutations in Rad51ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Rad51ap1 APN 6 126928160 missense probably damaging 1.00
IGL02371:Rad51ap1 APN 6 126927564 missense probably benign 0.14
IGL02398:Rad51ap1 APN 6 126928151 missense probably damaging 1.00
R0265:Rad51ap1 UTSW 6 126924197 makesense probably null
R0359:Rad51ap1 UTSW 6 126934741 missense probably damaging 1.00
R0488:Rad51ap1 UTSW 6 126934760 missense possibly damaging 0.94
R1527:Rad51ap1 UTSW 6 126928167 splice site probably null
R3018:Rad51ap1 UTSW 6 126939522 start gained probably null
R4464:Rad51ap1 UTSW 6 126934768 missense possibly damaging 0.94
R4691:Rad51ap1 UTSW 6 126927553 missense probably benign
R5469:Rad51ap1 UTSW 6 126928227 missense probably damaging 0.96
R7177:Rad51ap1 UTSW 6 126925020 missense probably benign 0.08
R8026:Rad51ap1 UTSW 6 126934712 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCATGACTGCCTAGTGTGG -3'
(R):5'- AGACGGTTTGTTCCAGTCTG -3'

Sequencing Primer
(F):5'- TCATGACTGCCTAGTGTGGAAGAC -3'
(R):5'- CCAGTCTGTGTTAATACGTGTTAG -3'
Posted On2017-12-01