Mutagenetix > Incidental Mutation

Incidental Mutation 'R5318:Hjurp'

500938

Institutional Source

Beutler Lab

Gene Symbol

Hjurp

Ensembl Gene

ENSMUSG00000044783

Gene Name

Holliday junction recognition protein

Synonyms

MMRRC Submission

042901-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R5318 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

88262471-88277633 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

GT to GTT at 88266524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118659 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000054674

SMART Domains

Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	11	68	1.5e-10	PFAM
low complexity region	159	175	N/A	INTRINSIC
low complexity region	215	232	N/A	INTRINSIC
Pfam:HJURP_mid	254	370	7.6e-54	PFAM
Pfam:HJURP_C	385	446	3.1e-26	PFAM
low complexity region	496	515	N/A	INTRINSIC
Pfam:HJURP_C	527	585	7.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061013

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000065420

SMART Domains

Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	2.9e-11	PFAM
low complexity region	83	99	N/A	INTRINSIC
low complexity region	139	156	N/A	INTRINSIC
Pfam:HJURP_mid	178	295	7.4e-64	PFAM
Pfam:HJURP_C	309	371	1.2e-26	PFAM
low complexity region	420	439	N/A	INTRINSIC
Pfam:HJURP_C	451	510	3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113130

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000127446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128532

Predicted Effect

probably benign
Transcript: ENSMUST00000147393

SMART Domains

Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	7.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148384

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	G	A	17: 35,567,986	E74K	possibly damaging	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Ankfn1	A	G	11: 89,391,928	S298P	probably damaging	Het
Arfgef2	A	C	2: 166,873,971	K1393N	probably damaging	Het
Atp4a	T	A	7: 30,715,329	V181E	probably damaging	Het
Bin3	A	G	14: 70,134,512	D134G	possibly damaging	Het
Cabs1	A	G	5: 87,980,566	T359A	possibly damaging	Het
Cblb	A	T	16: 52,186,198	K754N	possibly damaging	Het
Ccdc153	A	T	9: 44,245,765	R135*	probably null	Het
Cel	T	C	2: 28,557,708	E398G	possibly damaging	Het
Clip1	G	A	5: 123,613,084		probably benign	Het
Dnase2b	C	A	3: 146,582,455	R295L	probably benign	Het
Dnm3	G	A	1: 162,011,807	Q194*	probably null	Het
Dtx2	T	A	5: 136,012,100	S120T	possibly damaging	Het
Fat3	A	T	9: 16,376,629	S533T	probably damaging	Het
Foxred2	T	C	15: 77,952,398	I306V	probably benign	Het
Gdpd5	A	T	7: 99,453,027	T278S	probably benign	Het
Gli2	T	A	1: 118,844,470	T502S	probably damaging	Het
Gm10436	A	T	12: 88,176,228	C207S	probably benign	Het
Gm21830	A	T	2: 67,432,814		probably null	Het
Gm38394	A	G	1: 133,658,115	S495P	possibly damaging	Het
Gm5617	T	A	9: 48,495,911	I115N	possibly damaging	Het
Gpr75	G	T	11: 30,892,459	A455S	probably benign	Het
Grik3	A	G	4: 125,694,136	E683G	probably damaging	Het
Grin2b	T	C	6: 135,733,918	I877V	probably damaging	Het
Gsg1l2	G	T	11: 67,782,521	C109F	possibly damaging	Het
H2-Q4	G	A	17: 35,383,311	V341I	possibly damaging	Het
Kif5c	A	G	2: 49,671,828	K68R	probably benign	Het
Lct	T	A	1: 128,304,372	H580L	probably damaging	Het
Lrrtm4	A	G	6: 80,022,512	I302M	probably damaging	Het
Mef2b	A	T	8: 70,166,843	R228W	probably damaging	Het
Mtus2	T	A	5: 148,076,572	D58E	probably benign	Het
Myh15	T	G	16: 49,110,471	S603A	probably damaging	Het
Olfr26	C	T	9: 38,855,448	P129S	probably damaging	Het
Olfr283	A	G	15: 98,378,642	I156T	possibly damaging	Het
Olfr54	T	C	11: 51,027,593	V197A	probably benign	Het
P2rx4	G	A	5: 122,719,148	C149Y	probably null	Het
Proca1	T	A	11: 78,201,857	V43E	possibly damaging	Het
Rftn1	G	T	17: 49,994,458	N454K	probably benign	Het
Rrp15	T	C	1: 186,721,546	T235A	probably benign	Het
Serpina6	T	C	12: 103,653,962	E176G	possibly damaging	Het
Shprh	T	G	10: 11,166,557	I761M	probably benign	Het
Smg1	A	T	7: 118,160,204		probably benign	Het
Snupn	T	C	9: 56,957,061	S15P	probably damaging	Het
Tbc1d15	A	T	10: 115,208,969	Y509*	probably null	Het
Tcf4	T	C	18: 69,465,430	V72A	probably benign	Het
Tdrd3	T	C	14: 87,477,463		probably null	Het
Tm9sf4	T	A	2: 153,187,656	V175D	probably benign	Het
Vmn1r201	T	C	13: 22,474,922	L102P	probably damaging	Het
Wdfy4	T	A	14: 33,078,343	N1788I	possibly damaging	Het
Xpc	A	C	6: 91,493,010	V744G	probably damaging	Het
Xrcc6	T	C	15: 82,037,507	F178L	probably damaging	Het
Zfyve26	A	G	12: 79,270,850	V1196A	probably benign	Het

Other mutations in Hjurp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Hjurp	APN	1	88270269	missense	probably benign	0.04
IGL03099:Hjurp	APN	1	88266289	missense	probably benign	0.09
BB003:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
IGL03097:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03098:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03147:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
PIT4131001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
PIT4142001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
PIT4378001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
PIT4812001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R0053:Hjurp	UTSW	1	88277215	splice site	probably benign
R0371:Hjurp	UTSW	1	88277368	splice site	probably benign
R0442:Hjurp	UTSW	1	88266524	nonsense	probably null
R0762:Hjurp	UTSW	1	88277215	splice site	probably benign
R0928:Hjurp	UTSW	1	88266524	nonsense	probably null
R1333:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
R1342:Hjurp	UTSW	1	88277368	splice site	probably benign
R1364:Hjurp	UTSW	1	88266525	frame shift	probably null
R1496:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R1637:Hjurp	UTSW	1	88266121	missense	probably benign	0.03
R1905:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
R1965:Hjurp	UTSW	1	88266524	nonsense	probably null
R1992:Hjurp	UTSW	1	88266524	nonsense	probably null
R2002:Hjurp	UTSW	1	88266524	nonsense	probably null
R2023:Hjurp	UTSW	1	88266524	nonsense	probably null
R2024:Hjurp	UTSW	1	88266524	nonsense	probably null
R2332:Hjurp	UTSW	1	88277215	splice site	probably benign
R2420:Hjurp	UTSW	1	88266524	nonsense	probably null
R2422:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R2869:Hjurp	UTSW	1	88266524	nonsense	probably null
R2870:Hjurp	UTSW	1	88266524	nonsense	probably null
R2871:Hjurp	UTSW	1	88266524	nonsense	probably null
R2872:Hjurp	UTSW	1	88266524	nonsense	probably null
R3019:Hjurp	UTSW	1	88266524	nonsense	probably null
R3021:Hjurp	UTSW	1	88266524	nonsense	probably null
R3150:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R3411:Hjurp	UTSW	1	88266524	nonsense	probably null
R3552:Hjurp	UTSW	1	88266524	nonsense	probably null
R3704:Hjurp	UTSW	1	88277215	splice site	probably benign
R3730:Hjurp	UTSW	1	88266524	nonsense	probably null
R3733:Hjurp	UTSW	1	88266524	nonsense	probably null
R3764:Hjurp	UTSW	1	88266524	nonsense	probably null
R3799:Hjurp	UTSW	1	88277215	splice site	probably benign
R3819:Hjurp	UTSW	1	88277215	splice site	probably benign
R3857:Hjurp	UTSW	1	88266524	nonsense	probably null
R3930:Hjurp	UTSW	1	88266524	nonsense	probably null
R3952:Hjurp	UTSW	1	88277215	splice site	probably benign
R4090:Hjurp	UTSW	1	88277215	splice site	probably benign
R4159:Hjurp	UTSW	1	88277215	splice site	probably benign
R4207:Hjurp	UTSW	1	88277215	splice site	probably benign
R4322:Hjurp	UTSW	1	88277215	splice site	probably benign
R4391:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4392:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4397:Hjurp	UTSW	1	88266524	nonsense	probably null
R4700:Hjurp	UTSW	1	88266524	nonsense	probably null
R4808:Hjurp	UTSW	1	88277215	splice site	probably benign
R4900:Hjurp	UTSW	1	88266524	nonsense	probably null
R4901:Hjurp	UTSW	1	88266524	nonsense	probably null
R5023:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5024:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5076:Hjurp	UTSW	1	88266524	nonsense	probably null
R5123:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5236:Hjurp	UTSW	1	88266524	nonsense	probably null
R5300:Hjurp	UTSW	1	88266524	nonsense	probably null
R5370:Hjurp	UTSW	1	88266524	nonsense	probably null
R5410:Hjurp	UTSW	1	88266524	nonsense	probably null
R5445:Hjurp	UTSW	1	88266316	missense	probably benign	0.43
R5457:Hjurp	UTSW	1	88266525	frame shift	probably null
R5497:Hjurp	UTSW	1	88266320	missense	possibly damaging	0.92
R5560:Hjurp	UTSW	1	88266524	nonsense	probably null
R5561:Hjurp	UTSW	1	88266524	nonsense	probably null
R5615:Hjurp	UTSW	1	88266524	nonsense	probably null
R5661:Hjurp	UTSW	1	88277215	splice site	probably benign
R5722:Hjurp	UTSW	1	88266524	nonsense	probably null
R6087:Hjurp	UTSW	1	88266524	nonsense	probably null
R6089:Hjurp	UTSW	1	88266524	nonsense	probably null
R6090:Hjurp	UTSW	1	88266524	nonsense	probably null
R6125:Hjurp	UTSW	1	88266524	nonsense	probably null
R6175:Hjurp	UTSW	1	88266524	nonsense	probably null
R6362:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R6659:Hjurp	UTSW	1	88266524	nonsense	probably null
R7016:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7016:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7045:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7179:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7200:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7463:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7912:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R8215:Hjurp	UTSW	1	88266524	nonsense	probably null
R8968:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9038:Hjurp	UTSW	1	88266524	nonsense	probably null
R9115:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9133:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R9146:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R9221:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9475:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9482:Hjurp	UTSW	1	88266274	utr 3 prime	probably benign
R9565:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R9599:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
V5622:Hjurp	UTSW	1	88277525	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- ACTGTCATGGTTTGTGATGCCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'

Posted On

2017-12-01