Mutagenetix > Incidental Mutation

Incidental Mutation 'R5328:Tinag'

500944

Institutional Source

Beutler Lab

Gene Symbol

Tinag

Ensembl Gene

ENSMUSG00000032357

Gene Name

tubulointerstitial nephritis antigen

Synonyms

TIN-ag

MMRRC Submission

042843-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R5328 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76951693-77045794 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 77005631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 299 (G299*)

Ref Sequence

ENSEMBL: ENSMUSP00000034911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]

AlphaFold

Q9WUR0

Predicted Effect

probably null
Transcript: ENSMUST00000034911
AA Change: G299*

SMART Domains

Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: G299*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART
Pept_C1	216	466	1.83e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184897

SMART Domains

Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,837,694	V860E	possibly damaging	Het
Abcc6	T	C	7: 45,992,311	D881G	probably benign	Het
Abcc9	A	G	6: 142,682,059	V415A	probably benign	Het
Adgrb3	A	C	1: 25,094,275	N1003K	possibly damaging	Het
Adora3	C	T	3: 105,907,303	T123I	probably benign	Het
Amotl2	A	C	9: 102,723,768	T345P	probably benign	Het
Arap3	C	T	18: 37,991,687	E247K	possibly damaging	Het
Atp8b1	A	T	18: 64,531,391	D1235E	probably benign	Het
Axl	A	T	7: 25,773,411	V400E	probably damaging	Het
Brd8	T	A	18: 34,607,981	N431Y	probably benign	Het
Cadps	A	T	14: 12,457,790	N1025K	probably benign	Het
Cblc	A	T	7: 19,792,580	S195T	possibly damaging	Het
Chd2	C	T	7: 73,463,681	A1184T	possibly damaging	Het
Chst10	G	A	1: 38,895,962		probably benign	Het
Col12a1	T	C	9: 79,620,060	K2663E	probably damaging	Het
Cspg4	A	T	9: 56,885,856	I292L	probably benign	Het
Cul1	T	C	6: 47,508,317	V294A	probably damaging	Het
Cyp2d11	G	A	15: 82,391,771	P203L	probably benign	Het
Dscam	T	C	16: 96,673,678	H1228R	probably benign	Het
Eif3l	A	T	15: 79,093,361	K534*	probably null	Het
Enpep	T	C	3: 129,280,510	E796G	probably benign	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam117a	T	A	11: 95,364,170		probably null	Het
Fan1	A	T	7: 64,354,469	Y750N	probably damaging	Het
Fat4	T	A	3: 38,956,868	I2039N	probably damaging	Het
Gabrr2	G	T	4: 33,082,565	D106Y	probably damaging	Het
Gak	A	C	5: 108,617,001	C145G	possibly damaging	Het
Galnt14	A	T	17: 73,505,459	N406K	possibly damaging	Het
Gm10439	T	G	X: 149,636,163	*434E	probably null	Het
Gm10837	G	T	14: 122,490,778	R22L	unknown	Het
Gm19965	T	A	1: 116,821,418	H276Q	possibly damaging	Het
Gm43517	T	C	12: 49,391,156		probably benign	Het
Gm9733	T	C	3: 15,332,174	M17V	unknown	Het
Greb1l	A	T	18: 10,553,720	I1574F	probably damaging	Het
Gzme	G	A	14: 56,117,767	H236Y	probably benign	Het
Heatr5b	G	A	17: 78,826,362	T266I	possibly damaging	Het
Hk3	T	C	13: 55,013,493	I185V	probably benign	Het
Hnrnpr	A	G	4: 136,339,216	E302G	probably benign	Het
Itgal	T	C	7: 127,311,675		probably null	Het
Itk	A	G	11: 46,331,876	S583P	probably benign	Het
Loxhd1	A	T	18: 77,410,572	I1448F	probably damaging	Het
Macf1	GCCCCC	GCCCCCC	4: 123,350,991		probably null	Het
Man2a2	A	T	7: 80,368,756	F118L	probably benign	Het
Mfsd5	T	A	15: 102,281,012	V273E	probably damaging	Het
Nfe2l2	A	G	2: 75,676,856	L300P	probably damaging	Het
Nt5c1a	T	G	4: 123,208,993	L122R	possibly damaging	Het
Nt5c3b	A	G	11: 100,440,241	F42S	probably damaging	Het
Olfr332	C	A	11: 58,490,429	A109S	possibly damaging	Het
Olfr577	T	A	7: 102,973,968	N8I	possibly damaging	Het
Pabpc1	A	T	15: 36,602,877	D204E	probably benign	Het
Panx2	A	G	15: 89,068,095	N255S	probably damaging	Het
Pcnt	A	G	10: 76,411,719	L993P	probably damaging	Het
Pfas	A	T	11: 68,988,592	C1160S	probably damaging	Het
Plekhh3	T	A	11: 101,167,658		probably benign	Het
Plod3	T	A	5: 136,989,683	N258K	probably damaging	Het
Prr14l	T	C	5: 32,830,021	Q710R	probably benign	Het
Rnf216	G	T	5: 143,092,999	T65K	possibly damaging	Het
Samd9l	T	C	6: 3,376,739	E174G	probably damaging	Het
Sept12	T	A	16: 4,993,993	M63L	possibly damaging	Het
Sh3bgrl2	T	A	9: 83,577,456	D22E	probably benign	Het
Skil	A	G	3: 31,117,569	K488R	probably benign	Het
Slamf6	T	A	1: 171,938,095	I262K	probably benign	Het
Slc27a3	T	C	3: 90,386,832	D470G	probably damaging	Het
Sorbs3	A	T	14: 70,181,174	V680E	probably damaging	Het
Sox9	C	T	11: 112,782,658	T25I	probably benign	Het
Srsf1	G	T	11: 88,049,993		probably benign	Het
Stard9	A	C	2: 120,699,230	E1989D	probably damaging	Het
Thumpd2	T	A	17: 81,044,162	I277F	possibly damaging	Het
Tk2	A	T	8: 104,229,299		probably null	Het
Tmem44	A	G	16: 30,540,891	S210P	possibly damaging	Het
Traf3ip1	C	A	1: 91,520,069	P423T	probably damaging	Het
Trmt12	A	G	15: 58,872,855	D34G	probably damaging	Het
Ttc39b	A	G	4: 83,261,941	Y72H	probably damaging	Het
Ttn	G	A	2: 76,878,411		probably benign	Het
Ttyh2	T	A	11: 114,710,068	I381N	possibly damaging	Het
Uaca	A	T	9: 60,870,532	N734Y	probably benign	Het
Usp34	T	C	11: 23,464,616	I2853T	probably benign	Het
Usp34	G	A	11: 23,488,659	G3407D	probably benign	Het
Vmn2r78	A	G	7: 86,921,030	Y252C	probably damaging	Het
Wdr19	G	A	5: 65,244,179	C979Y	probably damaging	Het
Wdr92	C	A	11: 17,222,220	P103Q	probably damaging	Het
Yeats2	A	T	16: 20,171,205	H277L	probably damaging	Het
Zbtb2	T	C	10: 4,369,267	Y253C	possibly damaging	Het
Zfat	C	A	15: 68,179,828	G706C	probably damaging	Het
Zfp106	A	T	2: 120,520,417	N1584K	possibly damaging	Het

Other mutations in Tinag

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01450:Tinag	APN	9	77045576	missense	possibly damaging	0.93
IGL01524:Tinag	APN	9	77045538	missense	probably damaging	1.00
IGL01537:Tinag	APN	9	77045603	missense	probably benign	0.01
IGL01832:Tinag	APN	9	77031756	missense	probably benign	0.18
IGL02512:Tinag	APN	9	77031787	splice site	probably benign
IGL02888:Tinag	APN	9	77031713	missense	probably benign	0.24
G1citation:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R0179:Tinag	UTSW	9	76996882	splice site	probably benign
R0200:Tinag	UTSW	9	76951935	missense	probably damaging	1.00
R0206:Tinag	UTSW	9	76999852	missense	probably damaging	1.00
R0545:Tinag	UTSW	9	77031710	missense	possibly damaging	0.61
R0666:Tinag	UTSW	9	77005687	missense	probably benign	0.02
R0685:Tinag	UTSW	9	76952003	missense	probably damaging	1.00
R0732:Tinag	UTSW	9	77001654	missense	possibly damaging	0.93
R1445:Tinag	UTSW	9	77045516	missense	probably damaging	1.00
R2318:Tinag	UTSW	9	77045411	missense	probably damaging	1.00
R3809:Tinag	UTSW	9	76951905	missense	probably benign	0.15
R4747:Tinag	UTSW	9	76996956	missense	probably benign
R4781:Tinag	UTSW	9	76996950	missense	possibly damaging	0.69
R5110:Tinag	UTSW	9	76952007	missense	probably damaging	1.00
R5605:Tinag	UTSW	9	77045412	missense	probably damaging	1.00
R5897:Tinag	UTSW	9	77045444	missense	probably damaging	1.00
R6296:Tinag	UTSW	9	76996935	missense	possibly damaging	0.67
R6822:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R6915:Tinag	UTSW	9	77001615	missense	probably damaging	1.00
R7285:Tinag	UTSW	9	77045661	missense	probably benign
R7334:Tinag	UTSW	9	77001649	missense	probably damaging	1.00
R7974:Tinag	UTSW	9	76999849	missense	probably benign	0.01
R8354:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R8454:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R9029:Tinag	UTSW	9	77027014	splice site	probably benign
R9072:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9073:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9508:Tinag	UTSW	9	77005699	missense	probably damaging	1.00
Z1177:Tinag	UTSW	9	77045498	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGGCTGATAATGCTAGAAGCTG -3'
(R):5'- TTTGAAAATCAGTTGAGGGCTC -3'

Sequencing Primer
(F):5'- TGATAATGCTAGAAGCTGGGTATAAC -3'
(R):5'- GGTCGATACACAGCCAAT -3'

Posted On

2017-12-01