Incidental Mutation 'R5289:Grb10'
ID500946
Institutional Source Beutler Lab
Gene Symbol Grb10
Ensembl Gene ENSMUSG00000020176
Gene Namegrowth factor receptor bound protein 10
Synonyms5730571D09Rik, maternally expressed gene 1, Meg1
MMRRC Submission 042872-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R5289 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location11930508-12038683 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 11944924 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093321] [ENSMUST00000109653] [ENSMUST00000109654]
Predicted Effect silent
Transcript: ENSMUST00000093321
SMART Domains Protein: ENSMUSP00000091011
Gene: ENSMUSG00000020176

DomainStartEndE-ValueType
low complexity region 92 119 N/A INTRINSIC
RA 169 253 2.56e-20 SMART
PH 294 404 7.13e-10 SMART
Pfam:BPS 427 473 6.4e-31 PFAM
SH2 493 582 7.78e-30 SMART
Predicted Effect silent
Transcript: ENSMUST00000109653
SMART Domains Protein: ENSMUSP00000105280
Gene: ENSMUSG00000020176

DomainStartEndE-ValueType
low complexity region 92 119 N/A INTRINSIC
RA 169 253 2.56e-20 SMART
Blast:PH 285 358 1e-44 BLAST
Pfam:BPS 381 428 3.5e-33 PFAM
SH2 447 536 7.78e-30 SMART
Predicted Effect silent
Transcript: ENSMUST00000109654
SMART Domains Protein: ENSMUSP00000105281
Gene: ENSMUSG00000020176

DomainStartEndE-ValueType
RA 114 198 5.45e-24 SMART
PH 239 349 7.13e-10 SMART
Pfam:BPS 372 419 5.4e-33 PFAM
SH2 438 527 7.78e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148254
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. Overexpression of some isoforms of the encoded protein inhibits tyrosine kinase activity and results in growth suppression. This gene is imprinted in a highly isoform- and tissue-specific manner, with expression observed from the paternal allele in the brain, and from the maternal allele in the placental trophoblasts. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
PHENOTYPE: Maternal transmission of a mutant allele results in both fetal and placental overgrowth. Disproportionate overgrowth of the liver is observed. Paternal transmission of an allele lacking the differentially methylated region results in growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 37,000,109 Q3126K probably damaging Het
Adgrv1 A G 13: 81,521,084 V1731A probably benign Het
Ahcyl1 A G 3: 107,669,890 probably null Het
Aox1 T A 1: 58,092,558 M1042K probably damaging Het
Atp10d C A 5: 72,255,123 Q590K probably benign Het
Atp8b1 G T 18: 64,546,087 N774K possibly damaging Het
Atrnl1 C T 19: 57,657,082 T458M probably damaging Het
BC005561 G A 5: 104,519,657 V682I probably benign Het
Cnr1 T A 4: 33,943,910 C99* probably null Het
Cnr2 A G 4: 135,917,007 Y132C probably damaging Het
Commd9 C T 2: 101,898,894 A115V probably benign Het
Diaph3 A G 14: 86,981,678 F426S probably damaging Het
Diras1 G A 10: 81,022,244 Q58* probably null Het
Dpy19l2 A G 9: 24,695,997 L56P probably benign Het
Dsc1 A T 18: 20,101,853 V248D possibly damaging Het
Frem3 A G 8: 80,612,319 M414V probably benign Het
Frmd4b G T 6: 97,302,348 probably null Het
Gabarapl2 T C 8: 111,942,595 W62R probably damaging Het
Glt1d1 A G 5: 127,644,356 R36G probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc A G 2: 34,996,014 probably null Het
Hgd A G 16: 37,628,551 E379G possibly damaging Het
Ifi30 A T 8: 70,766,601 probably benign Het
Iqgap1 T C 7: 80,738,724 I842V possibly damaging Het
Iqsec3 T A 6: 121,386,700 probably null Het
Kalrn A G 16: 34,252,341 S724P possibly damaging Het
Lama2 C A 10: 27,212,073 G903* probably null Het
Lrrc10 T C 10: 117,045,487 V22A probably benign Het
Lzts3 T C 2: 130,636,101 E245G probably benign Het
Man2a1 A G 17: 64,651,227 T246A probably damaging Het
Mfsd13a A G 19: 46,368,280 E240G probably benign Het
Mtor T C 4: 148,466,092 I735T possibly damaging Het
Naa15 A T 3: 51,455,894 H333L probably damaging Het
Nes C A 3: 87,978,418 T1284K probably damaging Het
Nexn T G 3: 152,248,072 H173P probably benign Het
Nid2 T C 14: 19,805,311 V1173A possibly damaging Het
Npepps A G 11: 97,240,927 probably null Het
Pgm2 T A 4: 99,967,069 M313K probably damaging Het
Pih1d3 A T 1: 31,223,527 I197F probably benign Het
Plag1 T A 4: 3,905,545 K48N probably damaging Het
Prok1 G C 3: 107,239,619 L11V probably benign Het
Ptpn9 T C 9: 57,060,063 probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc38a4 A T 15: 97,010,348 F171I possibly damaging Het
Sycp1 A T 3: 102,934,253 N78K possibly damaging Het
Tas2r110 T C 6: 132,868,009 M1T probably null Het
Tmem260 G A 14: 48,486,810 V182M possibly damaging Het
Tmem30a A T 9: 79,776,154 N144K probably damaging Het
Vmn2r108 A G 17: 20,471,604 L219P probably damaging Het
Vmn2r57 A G 7: 41,399,974 S784P probably damaging Het
Vwf T C 6: 125,667,510 probably benign Het
Wdr62 A C 7: 30,267,875 V318G probably damaging Het
Zfp398 T A 6: 47,863,181 S115T probably benign Het
Zfp62 T A 11: 49,217,148 C689S probably damaging Het
Zmynd15 C G 11: 70,466,004 P580R unknown Het
Other mutations in Grb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Grb10 APN 11 11945599 missense probably damaging 1.00
IGL01450:Grb10 APN 11 11970432 missense probably damaging 1.00
IGL01872:Grb10 APN 11 11970547 missense probably damaging 0.99
IGL02164:Grb10 APN 11 11943962 missense probably damaging 1.00
IGL02508:Grb10 APN 11 11946767 missense probably damaging 1.00
IGL02626:Grb10 APN 11 11945503 missense probably benign 0.00
IGL03275:Grb10 APN 11 11933591 missense possibly damaging 0.46
R0042:Grb10 UTSW 11 11936798 missense probably damaging 1.00
R0042:Grb10 UTSW 11 11936798 missense probably damaging 1.00
R0089:Grb10 UTSW 11 11934192 splice site probably benign
R0196:Grb10 UTSW 11 11945583 missense probably damaging 1.00
R0419:Grb10 UTSW 11 11934207 missense possibly damaging 0.87
R0645:Grb10 UTSW 11 11936755 missense probably damaging 0.98
R1473:Grb10 UTSW 11 11934249 missense probably damaging 1.00
R1848:Grb10 UTSW 11 11946029 missense possibly damaging 0.78
R2025:Grb10 UTSW 11 11970576 nonsense probably null
R4455:Grb10 UTSW 11 11967665 missense possibly damaging 0.93
R4857:Grb10 UTSW 11 11951469 unclassified probably benign
R5522:Grb10 UTSW 11 11936746 missense probably benign 0.05
R5696:Grb10 UTSW 11 11933566 missense probably benign 0.23
R6119:Grb10 UTSW 11 11933551 missense probably damaging 1.00
R6163:Grb10 UTSW 11 11943932 nonsense probably null
R6267:Grb10 UTSW 11 11970639 start gained probably benign
R6328:Grb10 UTSW 11 11937905 missense probably damaging 1.00
R6741:Grb10 UTSW 11 11936717 critical splice donor site probably null
R7610:Grb10 UTSW 11 11943955 missense probably benign 0.33
R7641:Grb10 UTSW 11 11933492 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AACCAAATAGATACTGGCCAGG -3'
(R):5'- ATGGTTTTCACTCTACTGGAGC -3'

Sequencing Primer
(F):5'- TAGATACTGGCCAGGAGAAAACTCC -3'
(R):5'- GAGCTTATAGCACTACAGAC -3'
Posted On2017-12-01