Mutagenetix > Incidental Mutations

Incidental Mutation 'R5340:Smtnl1'

500948

Institutional Source

Beutler Lab

Gene Symbol

Smtnl1

Ensembl Gene

ENSMUSG00000027077

Gene Name

smoothelin-like 1

Synonyms

Chasm, 1110030K22Rik

MMRRC Submission

042919-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5340 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84811176-84822652 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84815441 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 362 (H362L)

Ref Sequence

ENSEMBL: ENSMUSP00000028471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028471]

PDB Structure

The Solution Structure of Calponin Homology Domain from Smoothelin-like 1 [SOLUTION NMR]
HADDOCK-derived structure of the CH-domain of the smoothelin-like 1 complexed with the C-domain of apocalmodulin [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028471
AA Change: H362L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077
AA Change: H362L

Domain	Start	End	E-Value	Type
low complexity region	56	72	N/A	INTRINSIC
coiled coil region	124	154	N/A	INTRINSIC
low complexity region	218	230	N/A	INTRINSIC
low complexity region	236	246	N/A	INTRINSIC
low complexity region	260	285	N/A	INTRINSIC
CH	345	444	5.55e-18	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the contraction of both striated and smooth muscle. During pregnancy, the encoded protein interacts with progesterone receptor to attenuate the expression of contractile and metabolic proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit vascular and muscular adaptations normally found in exercised animals as well as increased exercise endurance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	C	T	13: 98,984,443	R25H	possibly damaging	Het
Aqp7	T	C	4: 41,034,347	R271G	probably benign	Het
Atp4a	A	G	7: 30,720,806	I793V	probably benign	Het
Baz2a	C	T	10: 128,115,042	R535C	probably damaging	Het
BC034090	T	C	1: 155,226,414	T35A	possibly damaging	Het
Bnip1	T	C	17: 26,786,790		probably null	Het
Ccdc136	A	G	6: 29,411,860	S369G	possibly damaging	Het
Csrnp3	A	G	2: 66,022,437	D391G	probably benign	Het
Ctbp2	G	T	7: 133,013,963	H414Q	probably benign	Het
Dnah6	A	G	6: 73,212,620	I15T	probably benign	Het
Dync2li1	A	G	17: 84,649,702		probably null	Het
Eri3	A	T	4: 117,673,794	I329F	probably damaging	Het
Fam105a	T	C	15: 27,658,089	M282V	possibly damaging	Het
Flii	T	A	11: 60,717,268	I786F	probably damaging	Het
Fmo1	A	T	1: 162,829,982	I530N	probably benign	Het
Gm10334	T	C	6: 41,445,373	N33D	probably benign	Het
Gm28042	T	C	2: 120,041,448	S960P	probably benign	Het
Gzmm	C	A	10: 79,695,073	F236L	probably benign	Het
Igkv4-55	A	G	6: 69,607,505	V41A	probably damaging	Het
Ipo9	A	G	1: 135,385,432	Y1020H	probably benign	Het
Masp1	T	C	16: 23,458,108	Y549C	probably damaging	Het
Mblac1	A	T	5: 138,194,578	S61C	probably damaging	Het
Mical1	T	A	10: 41,483,431		probably null	Het
Mroh9	C	T	1: 163,080,587		probably benign	Het
Mta2	T	C	19: 8,942,356	M1T	probably null	Het
Neb	A	G	2: 52,223,048	Y4245H	probably damaging	Het
Olfr1263	T	C	2: 90,015,362	V144A	probably benign	Het
Olfr736	T	C	14: 50,393,220	F155L	probably damaging	Het
Pak2	G	T	16: 32,034,946		probably null	Het
Phc3	A	T	3: 30,907,467	F939I	probably damaging	Het
Rogdi	C	A	16: 5,013,361	R14L	probably benign	Het
Ryr3	T	C	2: 112,834,125	Y1627C	probably damaging	Het
Scrn3	A	T	2: 73,335,810	K396*	probably null	Het
Sh3pxd2a	T	C	19: 47,268,231	N683D	probably benign	Het
Sned1	A	G	1: 93,282,757	S927G	probably benign	Het
Tcaf1	A	G	6: 42,678,989	V351A	probably damaging	Het
Tmem232	C	T	17: 65,402,998	V432M	possibly damaging	Het
Ttll11	G	T	2: 35,902,789	H347Q	probably damaging	Het
Vmn2r56	A	C	7: 12,715,872	D146E	probably damaging	Het
Wwp1	A	G	4: 19,638,773		probably null	Het
Zcchc7	T	A	4: 44,762,245	N124K	probably benign	Het
Zfp667	A	G	7: 6,305,253	T307A	possibly damaging	Het
Zfp709	T	A	8: 71,889,752	C342S	probably damaging	Het
Zfp940	A	G	7: 29,844,841	V547A	probably benign	Het

Other mutations in Smtnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01135:Smtnl1	APN	2	84818887	missense	probably benign
IGL01702:Smtnl1	APN	2	84818690	missense	possibly damaging	0.71
IGL01836:Smtnl1	APN	2	84815370	missense	probably damaging	1.00
IGL01866:Smtnl1	APN	2	84818745	missense	possibly damaging	0.80
IGL01869:Smtnl1	APN	2	84811397	makesense	probably null
IGL01989:Smtnl1	APN	2	84818470	missense	probably benign	0.22
IGL02247:Smtnl1	APN	2	84817028	splice site	probably benign
R1442:Smtnl1	UTSW	2	84818436	missense	probably damaging	0.97
R4577:Smtnl1	UTSW	2	84818443	missense	possibly damaging	0.50
R5524:Smtnl1	UTSW	2	84818894	missense	probably benign	0.05
R5561:Smtnl1	UTSW	2	84818395	missense	probably benign	0.31
R5631:Smtnl1	UTSW	2	84818754	missense	probably benign
R5997:Smtnl1	UTSW	2	84815378	missense	probably damaging	1.00
R6050:Smtnl1	UTSW	2	84811453	missense	probably damaging	1.00
R6433:Smtnl1	UTSW	2	84818368	missense	probably benign	0.03
R7011:Smtnl1	UTSW	2	84818409	missense	probably benign	0.01
R8390:Smtnl1	UTSW	2	84815350	nonsense	probably null
R8406:Smtnl1	UTSW	2	84818398	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCCAGAACTGAGGCTTACTC -3'
(R):5'- TGTTCCGGAACACAAAGGC -3'

Sequencing Primer
(F):5'- AACTGAGGCTTACTCTGCAG -3'
(R):5'- CCATCGGTGGTGTCAAGAAC -3'

Posted On

2017-12-01