Incidental Mutation 'R5340:Smtnl1'
ID 500948
Institutional Source Beutler Lab
Gene Symbol Smtnl1
Ensembl Gene ENSMUSG00000027077
Gene Name smoothelin-like 1
Synonyms Chasm, 1110030K22Rik
MMRRC Submission 042919-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5340 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 84811176-84822652 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84815441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 362 (H362L)
Ref Sequence ENSEMBL: ENSMUSP00000028471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028471]
AlphaFold Q99LM3
PDB Structure The Solution Structure of Calponin Homology Domain from Smoothelin-like 1 [SOLUTION NMR]
HADDOCK-derived structure of the CH-domain of the smoothelin-like 1 complexed with the C-domain of apocalmodulin [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000028471
AA Change: H362L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077
AA Change: H362L

DomainStartEndE-ValueType
low complexity region 56 72 N/A INTRINSIC
coiled coil region 124 154 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 260 285 N/A INTRINSIC
CH 345 444 5.55e-18 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the contraction of both striated and smooth muscle. During pregnancy, the encoded protein interacts with progesterone receptor to attenuate the expression of contractile and metabolic proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit vascular and muscular adaptations normally found in exercised animals as well as increased exercise endurance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik C T 13: 98,984,443 R25H possibly damaging Het
Aqp7 T C 4: 41,034,347 R271G probably benign Het
Atp4a A G 7: 30,720,806 I793V probably benign Het
Baz2a C T 10: 128,115,042 R535C probably damaging Het
BC034090 T C 1: 155,226,414 T35A possibly damaging Het
Bnip1 T C 17: 26,786,790 probably null Het
Ccdc136 A G 6: 29,411,860 S369G possibly damaging Het
Csrnp3 A G 2: 66,022,437 D391G probably benign Het
Ctbp2 G T 7: 133,013,963 H414Q probably benign Het
Dnah6 A G 6: 73,212,620 I15T probably benign Het
Dync2li1 A G 17: 84,649,702 probably null Het
Eri3 A T 4: 117,673,794 I329F probably damaging Het
Fam105a T C 15: 27,658,089 M282V possibly damaging Het
Flii T A 11: 60,717,268 I786F probably damaging Het
Fmo1 A T 1: 162,829,982 I530N probably benign Het
Gm10334 T C 6: 41,445,373 N33D probably benign Het
Gm28042 T C 2: 120,041,448 S960P probably benign Het
Gzmm C A 10: 79,695,073 F236L probably benign Het
Igkv4-55 A G 6: 69,607,505 V41A probably damaging Het
Ipo9 A G 1: 135,385,432 Y1020H probably benign Het
Masp1 T C 16: 23,458,108 Y549C probably damaging Het
Mblac1 A T 5: 138,194,578 S61C probably damaging Het
Mical1 T A 10: 41,483,431 probably null Het
Mroh9 C T 1: 163,080,587 probably benign Het
Mta2 T C 19: 8,942,356 M1T probably null Het
Neb A G 2: 52,223,048 Y4245H probably damaging Het
Olfr1263 T C 2: 90,015,362 V144A probably benign Het
Olfr736 T C 14: 50,393,220 F155L probably damaging Het
Pak2 G T 16: 32,034,946 probably null Het
Phc3 A T 3: 30,907,467 F939I probably damaging Het
Rogdi C A 16: 5,013,361 R14L probably benign Het
Ryr3 T C 2: 112,834,125 Y1627C probably damaging Het
Scrn3 A T 2: 73,335,810 K396* probably null Het
Sh3pxd2a T C 19: 47,268,231 N683D probably benign Het
Sned1 A G 1: 93,282,757 S927G probably benign Het
Tcaf1 A G 6: 42,678,989 V351A probably damaging Het
Tmem232 C T 17: 65,402,998 V432M possibly damaging Het
Ttll11 G T 2: 35,902,789 H347Q probably damaging Het
Vmn2r56 A C 7: 12,715,872 D146E probably damaging Het
Wwp1 A G 4: 19,638,773 probably null Het
Zcchc7 T A 4: 44,762,245 N124K probably benign Het
Zfp667 A G 7: 6,305,253 T307A possibly damaging Het
Zfp709 T A 8: 71,889,752 C342S probably damaging Het
Zfp940 A G 7: 29,844,841 V547A probably benign Het
Other mutations in Smtnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Smtnl1 APN 2 84818887 missense probably benign
IGL01702:Smtnl1 APN 2 84818690 missense possibly damaging 0.71
IGL01836:Smtnl1 APN 2 84815370 missense probably damaging 1.00
IGL01866:Smtnl1 APN 2 84818745 missense possibly damaging 0.80
IGL01869:Smtnl1 APN 2 84811397 makesense probably null
IGL01989:Smtnl1 APN 2 84818470 missense probably benign 0.22
IGL02247:Smtnl1 APN 2 84817028 splice site probably benign
R1442:Smtnl1 UTSW 2 84818436 missense probably damaging 0.97
R4577:Smtnl1 UTSW 2 84818443 missense possibly damaging 0.50
R5524:Smtnl1 UTSW 2 84818894 missense probably benign 0.05
R5561:Smtnl1 UTSW 2 84818395 missense probably benign 0.31
R5631:Smtnl1 UTSW 2 84818754 missense probably benign
R5997:Smtnl1 UTSW 2 84815378 missense probably damaging 1.00
R6050:Smtnl1 UTSW 2 84811453 missense probably damaging 1.00
R6433:Smtnl1 UTSW 2 84818368 missense probably benign 0.03
R7011:Smtnl1 UTSW 2 84818409 missense probably benign 0.01
R8390:Smtnl1 UTSW 2 84815350 nonsense probably null
R8406:Smtnl1 UTSW 2 84818398 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCAGAACTGAGGCTTACTC -3'
(R):5'- TGTTCCGGAACACAAAGGC -3'

Sequencing Primer
(F):5'- AACTGAGGCTTACTCTGCAG -3'
(R):5'- CCATCGGTGGTGTCAAGAAC -3'
Posted On 2017-12-01