Incidental Mutation 'R5340:Wwp1'
ID500949
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene NameWW domain containing E3 ubiquitin protein ligase 1
SynonymsTiul1, SDRP1, 8030445B08Rik, AIP5
MMRRC Submission 042919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5340 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location19608303-19708993 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 19638773 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246] [ENSMUST00000108246] [ENSMUST00000108250]
Predicted Effect probably null
Transcript: ENSMUST00000035982
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108246
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108246
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108250
SMART Domains Protein: ENSMUSP00000103885
Gene: ENSMUSG00000078772

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik C T 13: 98,984,443 R25H possibly damaging Het
Aqp7 T C 4: 41,034,347 R271G probably benign Het
Atp4a A G 7: 30,720,806 I793V probably benign Het
Baz2a C T 10: 128,115,042 R535C probably damaging Het
BC034090 T C 1: 155,226,414 T35A possibly damaging Het
Bnip1 T C 17: 26,786,790 probably null Het
Ccdc136 A G 6: 29,411,860 S369G possibly damaging Het
Csrnp3 A G 2: 66,022,437 D391G probably benign Het
Ctbp2 G T 7: 133,013,963 H414Q probably benign Het
Dnah6 A G 6: 73,212,620 I15T probably benign Het
Dync2li1 A G 17: 84,649,702 probably null Het
Eri3 A T 4: 117,673,794 I329F probably damaging Het
Fam105a T C 15: 27,658,089 M282V possibly damaging Het
Flii T A 11: 60,717,268 I786F probably damaging Het
Fmo1 A T 1: 162,829,982 I530N probably benign Het
Gm10334 T C 6: 41,445,373 N33D probably benign Het
Gm28042 T C 2: 120,041,448 S960P probably benign Het
Gzmm C A 10: 79,695,073 F236L probably benign Het
Igkv4-55 A G 6: 69,607,505 V41A probably damaging Het
Ipo9 A G 1: 135,385,432 Y1020H probably benign Het
Masp1 T C 16: 23,458,108 Y549C probably damaging Het
Mblac1 A T 5: 138,194,578 S61C probably damaging Het
Mical1 T A 10: 41,483,431 probably null Het
Mroh9 C T 1: 163,080,587 probably benign Het
Mta2 T C 19: 8,942,356 M1T probably null Het
Neb A G 2: 52,223,048 Y4245H probably damaging Het
Olfr1263 T C 2: 90,015,362 V144A probably benign Het
Olfr736 T C 14: 50,393,220 F155L probably damaging Het
Pak2 G T 16: 32,034,946 probably null Het
Phc3 A T 3: 30,907,467 F939I probably damaging Het
Rogdi C A 16: 5,013,361 R14L probably benign Het
Ryr3 T C 2: 112,834,125 Y1627C probably damaging Het
Scrn3 A T 2: 73,335,810 K396* probably null Het
Sh3pxd2a T C 19: 47,268,231 N683D probably benign Het
Smtnl1 T A 2: 84,815,441 H362L probably damaging Het
Sned1 A G 1: 93,282,757 S927G probably benign Het
Tcaf1 A G 6: 42,678,989 V351A probably damaging Het
Tmem232 C T 17: 65,402,998 V432M possibly damaging Het
Ttll11 G T 2: 35,902,789 H347Q probably damaging Het
Vmn2r56 A C 7: 12,715,872 D146E probably damaging Het
Zcchc7 T A 4: 44,762,245 N124K probably benign Het
Zfp667 A G 7: 6,305,253 T307A possibly damaging Het
Zfp709 T A 8: 71,889,752 C342S probably damaging Het
Zfp940 A G 7: 29,844,841 V547A probably benign Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19650360 missense probably benign
IGL00945:Wwp1 APN 4 19640193 critical splice donor site probably null
IGL01338:Wwp1 APN 4 19627636 missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19662115 splice site probably benign
IGL02969:Wwp1 APN 4 19623200 missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19678408 missense probably damaging 0.97
BB008:Wwp1 UTSW 4 19650114 critical splice donor site probably null
BB018:Wwp1 UTSW 4 19650114 critical splice donor site probably null
PIT4243001:Wwp1 UTSW 4 19638631 missense probably damaging 0.99
R0035:Wwp1 UTSW 4 19631116 missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19641725 intron probably benign
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0391:Wwp1 UTSW 4 19627911 missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19638763 intron probably benign
R1604:Wwp1 UTSW 4 19659709 missense probably benign
R1716:Wwp1 UTSW 4 19659698 missense probably benign 0.00
R1778:Wwp1 UTSW 4 19627892 nonsense probably null
R1832:Wwp1 UTSW 4 19650197 missense probably benign 0.33
R2073:Wwp1 UTSW 4 19662181 missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19650390 missense probably benign 0.00
R2228:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19638618 missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19662032 missense probably benign 0.07
R2349:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R3761:Wwp1 UTSW 4 19631085 missense probably damaging 1.00
R4062:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4732:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4733:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4838:Wwp1 UTSW 4 19662143 missense probably benign 0.31
R4936:Wwp1 UTSW 4 19638804 missense probably damaging 0.96
R5262:Wwp1 UTSW 4 19631057 missense probably damaging 1.00
R5847:Wwp1 UTSW 4 19662174 missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19650299 missense possibly damaging 0.94
R6602:Wwp1 UTSW 4 19641816 missense probably damaging 1.00
R6628:Wwp1 UTSW 4 19661963 splice site probably null
R7017:Wwp1 UTSW 4 19623124 missense probably damaging 1.00
R7195:Wwp1 UTSW 4 19627908 missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19611782 missense probably damaging 1.00
R7450:Wwp1 UTSW 4 19640016 missense probably damaging 0.99
R7488:Wwp1 UTSW 4 19627660 missense probably damaging 0.99
R7617:Wwp1 UTSW 4 19662188 missense probably benign 0.00
R7707:Wwp1 UTSW 4 19627645 missense probably benign 0.31
R7812:Wwp1 UTSW 4 19639991 missense probably damaging 0.99
R7864:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R7931:Wwp1 UTSW 4 19650114 critical splice donor site probably null
R8006:Wwp1 UTSW 4 19650174 missense probably benign
R8851:Wwp1 UTSW 4 19643437 missense probably null 1.00
X0018:Wwp1 UTSW 4 19640261 missense probably benign 0.41
X0062:Wwp1 UTSW 4 19638794 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCCTTACCTGTTGGAAGGAATCTTC -3'
(R):5'- AGTGGCAACCTTCATGACGC -3'

Sequencing Primer
(F):5'- CAAATAATGTCTGTCGGGACAC -3'
(R):5'- TGTCCTAGCAGATAGACCTGTAC -3'
Posted On2017-12-01