Incidental Mutation 'R5343:Camk4'
ID500954
Institutional Source Beutler Lab
Gene Symbol Camk4
Ensembl Gene ENSMUSG00000038128
Gene Namecalcium/calmodulin-dependent protein kinase IV
SynonymsD18Bwg0362e, CaMKIV/Gr, CaMKIV, Ca2+/calmodulin-dependent protein kinase type IV/Gr, A430110E23Rik
MMRRC Submission 042922-MU
Accession Numbers

Genbank: NM_009793; MGI: 88258

Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5343 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location32939041-33195767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33078069 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 76 (T76A)
Ref Sequence ENSEMBL: ENSMUSP00000046539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042868]
Predicted Effect probably damaging
Transcript: ENSMUST00000042868
AA Change: T76A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046539
Gene: ENSMUSG00000038128
AA Change: T76A

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
S_TKc 42 296 8.7e-106 SMART
low complexity region 318 344 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. This enzyme is a multifunctional serine/threonine protein kinase with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for different targeted mutations show variable phenotypes, including reduced viability, male and/or female sterility, and mild to severe neurological and spatial memory disorders. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(3) Targeted, other(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik C A 17: 46,773,036 A75E probably damaging Het
5730559C18Rik G T 1: 136,225,442 H237Q probably benign Het
Adck5 G A 15: 76,595,580 R560H probably damaging Het
Ahctf1 A T 1: 179,770,634 Y964* probably null Het
Alg8 T C 7: 97,386,919 I339T possibly damaging Het
Alox5 T C 6: 116,413,507 D503G possibly damaging Het
Cdh3 T C 8: 106,552,936 V728A probably benign Het
Chd4 T A 6: 125,120,363 N1326K probably damaging Het
Cnn1 A T 9: 22,105,410 Y48F probably benign Het
Dnah6 T A 6: 73,212,616 E16D probably benign Het
Ezh2 A G 6: 47,576,615 L56S probably damaging Het
F13b T C 1: 139,510,544 V299A possibly damaging Het
Hydin T C 8: 110,485,419 S1279P probably benign Het
Ift172 T C 5: 31,263,812 M981V probably benign Het
Lpl T A 8: 68,895,737 V206E probably damaging Het
Mre11a A G 9: 14,811,834 D368G probably damaging Het
Mreg G A 1: 72,160,958 P191L probably damaging Het
Mtif2 G T 11: 29,536,964 A134S probably damaging Het
Mxd4 T C 5: 34,177,730 S114G probably benign Het
Myo1b T C 1: 51,778,537 Q522R probably benign Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Ninl T C 2: 150,971,190 E182G probably benign Het
Notch3 T C 17: 32,143,283 N1456S probably benign Het
Npr1 G T 3: 90,458,208 N648K possibly damaging Het
Oas3 A G 5: 120,756,238 S1016P possibly damaging Het
Olfr1499 T C 19: 13,814,960 N210S probably damaging Het
Olfr518 C T 7: 108,880,998 V203M possibly damaging Het
Palld A G 8: 61,549,815 probably benign Het
Patj T G 4: 98,676,193 I1021S probably damaging Het
Pfpl T A 19: 12,428,688 L101Q probably damaging Het
Pilrb2 T A 5: 137,870,966 E124V possibly damaging Het
Pomk A G 8: 25,983,016 F303S probably benign Het
Rap1gap2 A T 11: 74,441,785 S65T probably damaging Het
Sema3a G A 5: 13,473,406 C114Y probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Spry4 A T 18: 38,589,975 V245E probably damaging Het
Srrt T C 5: 137,297,165 Y271C probably damaging Het
Tas2r136 A G 6: 132,778,080 V28A probably benign Het
Tenm2 A G 11: 36,069,503 V998A probably benign Het
Trim37 A G 11: 87,137,603 E46G probably damaging Het
Ubiad1 A G 4: 148,436,435 V244A possibly damaging Het
Other mutations in Camk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
7510:Camk4 UTSW 18 33156839 missense probably null 0.99
R0244:Camk4 UTSW 18 33179625 critical splice donor site probably null
R0408:Camk4 UTSW 18 33129792 missense probably damaging 1.00
R0744:Camk4 UTSW 18 32939454 missense unknown
R0836:Camk4 UTSW 18 32939454 missense unknown
R0903:Camk4 UTSW 18 33182330 missense probably benign 0.08
R1449:Camk4 UTSW 18 32939475 missense probably damaging 0.99
R1456:Camk4 UTSW 18 33129843 splice site probably benign
R1677:Camk4 UTSW 18 33176222 missense probably damaging 1.00
R1733:Camk4 UTSW 18 33078021 missense possibly damaging 0.54
R1909:Camk4 UTSW 18 33158816 splice site probably null
R2186:Camk4 UTSW 18 33182341 missense probably damaging 0.99
R2291:Camk4 UTSW 18 33107943 critical splice donor site probably null
R3874:Camk4 UTSW 18 33158854 missense possibly damaging 0.70
R3968:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3969:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3970:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R4858:Camk4 UTSW 18 33176213 missense probably damaging 0.98
R5251:Camk4 UTSW 18 33184879 missense probably benign 0.31
R5972:Camk4 UTSW 18 33107926 missense probably damaging 1.00
R6155:Camk4 UTSW 18 32939447 missense unknown
R6728:Camk4 UTSW 18 33184939 missense probably benign
R7088:Camk4 UTSW 18 32939531 missense probably benign 0.02
R7135:Camk4 UTSW 18 33107943 critical splice donor site probably null
R7372:Camk4 UTSW 18 33185125 missense probably benign 0.34
R7490:Camk4 UTSW 18 32939545 critical splice donor site probably null
R7525:Camk4 UTSW 18 33185032 missense probably benign 0.04
R7890:Camk4 UTSW 18 33185005 missense probably benign 0.01
R8446:Camk4 UTSW 18 33156757 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCAGCATCTAGAACTTAGGAA -3'
(R):5'- TTCTCCACAAATCACGTCCC -3'

Sequencing Primer
(F):5'- AGGAATCCTTGTTAGCCATGAGC -3'
(R):5'- GTCCCACTTAAGAACCAGTGACTG -3'
Posted On2017-12-01