Incidental Mutation 'R5345:Setd5'
ID500957
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene NameSET domain containing 5
Synonyms2900045N06Rik
MMRRC Submission 042924-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5345 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113077365-113153435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113116007 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 340 (P340L)
Ref Sequence ENSEMBL: ENSMUSP00000108782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042889
AA Change: P321L

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: P321L

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113155
AA Change: P340L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: P340L

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113157
AA Change: P340L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: P340L

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141072
AA Change: P563L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142215
AA Change: P398L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204377
Meta Mutation Damage Score 0.4971 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,179,177 T158M probably benign Het
Abl1 T A 2: 31,797,047 S519T probably damaging Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acot1 T A 12: 84,017,168 I350N probably damaging Het
Adam8 A G 7: 139,987,639 V397A probably benign Het
Ankar A G 1: 72,670,151 M735T possibly damaging Het
B020031M17Rik A T 13: 119,949,848 V74E probably damaging Het
Cacna1c A G 6: 118,656,536 probably null Het
Cdc25b A G 2: 131,192,596 S222G probably benign Het
Celsr3 T C 9: 108,832,124 S1390P probably damaging Het
Clca4a T G 3: 144,970,461 D104A probably damaging Het
Clcn6 A T 4: 148,038,749 probably benign Het
Coq8b A G 7: 27,250,348 T320A probably benign Het
Cspg5 A T 9: 110,246,630 M145L probably benign Het
Cyp2c67 T A 19: 39,626,232 I284F probably benign Het
Eya4 T C 10: 23,110,048 I565V probably benign Het
Fbxw11 A G 11: 32,738,471 N410S probably damaging Het
Gabrb2 C T 11: 42,626,809 A448V possibly damaging Het
Gm11487 A T 4: 73,401,277 W77R probably damaging Het
Hectd4 A G 5: 121,263,974 D375G possibly damaging Het
Itsn2 T C 12: 4,672,783 V1073A probably damaging Het
Kif5c A G 2: 49,723,066 T139A probably benign Het
L1td1 G A 4: 98,736,447 G293D probably damaging Het
Lama1 A G 17: 67,817,563 M2873V probably benign Het
Myo15 A G 11: 60,497,538 R1960G probably damaging Het
Nbeal1 T C 1: 60,328,210 probably null Het
Ndufb4 A G 16: 37,654,178 probably null Het
Nup153 A T 13: 46,686,865 L1089* probably null Het
Olfr1107 A G 2: 87,071,492 V214A possibly damaging Het
Olfr1512 G A 14: 52,372,268 R262* probably null Het
Olfr168 T A 16: 19,530,777 I48F probably damaging Het
P2rx1 A G 11: 73,009,230 T158A probably damaging Het
Park7 A G 4: 150,908,423 probably benign Het
Parl A T 16: 20,298,142 F102I probably damaging Het
Plxnc1 T A 10: 94,849,969 H720L probably benign Het
Ptpn4 A G 1: 119,765,477 S140P probably benign Het
Rel A G 11: 23,742,462 S524P probably benign Het
Ripply2 A G 9: 87,019,726 probably null Het
Rps4l-ps T C 7: 114,927,198 noncoding transcript Het
Rtn4ip1 T C 10: 43,932,470 L81P probably damaging Het
Sap130 T C 18: 31,648,198 L138P probably benign Het
Scp2 A T 4: 108,055,579 probably null Het
Sec24c T A 14: 20,693,220 M970K probably benign Het
Sgcg A T 14: 61,245,769 M61K probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Slc34a1 A G 13: 55,400,518 R21G probably benign Het
Slc7a14 A C 3: 31,223,857 L533W probably damaging Het
Srsf9 A G 5: 115,330,536 D77G probably benign Het
Tab1 A T 15: 80,149,813 E119V possibly damaging Het
Tnrc6c C T 11: 117,723,287 A757V possibly damaging Het
Tradd A T 8: 105,259,924 I72N probably damaging Het
Trbv12-1 C T 6: 41,113,847 T51M probably benign Het
Tsga10 T C 1: 37,763,311 K605E probably damaging Het
Vwc2l A G 1: 70,728,918 D47G probably damaging Het
Zfp647 T A 15: 76,911,495 T322S possibly damaging Het
Zscan20 A C 4: 128,588,121 S583A probably benign Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
R7515:Setd5 UTSW 6 113110889 missense probably damaging 1.00
R7621:Setd5 UTSW 6 113144049 missense possibly damaging 0.85
R7652:Setd5 UTSW 6 113121764 missense probably damaging 1.00
R7986:Setd5 UTSW 6 113128457 missense probably benign 0.00
R8083:Setd5 UTSW 6 113115010 missense probably damaging 1.00
R8175:Setd5 UTSW 6 113114913 missense probably damaging 1.00
R8252:Setd5 UTSW 6 113150955 missense probably benign 0.01
R8268:Setd5 UTSW 6 113149690 critical splice donor site probably null
R8271:Setd5 UTSW 6 113115070 missense possibly damaging 0.58
R8424:Setd5 UTSW 6 113149683 missense probably benign 0.12
R8508:Setd5 UTSW 6 113121087 missense probably damaging 1.00
R8801:Setd5 UTSW 6 113150892 missense possibly damaging 0.95
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Z1176:Setd5 UTSW 6 113138096 missense probably benign
Z1191:Setd5 UTSW 6 113114996 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGGCAAATAAATCTGCAAATCGTG -3'
(R):5'- ATTAAACATGTCCTTTGATGGCTCC -3'

Sequencing Primer
(F):5'- ACACTAGTGATGACTCCTTTCCAAG -3'
(R):5'- CCTTTGATGGCTCCATTGAAAG -3'
Posted On2017-12-01