Incidental Mutation 'R0130:Klhl23'
ID 50097
Institutional Source Beutler Lab
Gene Symbol Klhl23
Ensembl Gene ENSMUSG00000042155
Gene Name kelch-like 23
Synonyms C130068N17Rik
MMRRC Submission 038415-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R0130 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 2
Chromosomal Location 69652288-69666995 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69664310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 553 (V553A)
Ref Sequence ENSEMBL: ENSMUSP00000050219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053087]
AlphaFold Q6GQU2
Predicted Effect probably damaging
Transcript: ENSMUST00000053087
AA Change: V553A

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050219
Gene: ENSMUSG00000042155
AA Change: V553A

DomainStartEndE-ValueType
BTB 36 134 8.34e-27 SMART
BACK 139 240 8.51e-23 SMART
Kelch 274 319 5.19e0 SMART
Kelch 321 369 5.85e-10 SMART
Kelch 370 416 7.78e-6 SMART
Kelch 417 466 2.11e-1 SMART
Kelch 467 508 3.8e-9 SMART
Kelch 509 557 2.25e-11 SMART
Meta Mutation Damage Score 0.4810 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,994,094 (GRCm39) Y37F probably damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Apol7c A G 15: 77,410,562 (GRCm39) I128T possibly damaging Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Arfip2 A G 7: 105,288,205 (GRCm39) probably benign Het
Atp5mf A T 5: 145,124,992 (GRCm39) probably benign Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
Cd22 A G 7: 30,569,389 (GRCm39) Y402H possibly damaging Het
Cd248 A G 19: 5,119,990 (GRCm39) T613A probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Cenpc1 A T 5: 86,194,405 (GRCm39) D120E probably benign Het
Chd3 T A 11: 69,250,656 (GRCm39) H691L probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
Ctnnd2 A T 15: 30,922,059 (GRCm39) E895V probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,585,108 (GRCm39) T837K probably benign Het
Eif2ak3 C A 6: 70,858,716 (GRCm39) probably benign Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Fat2 T A 11: 55,142,944 (GRCm39) M4302L probably benign Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Gde1 A T 7: 118,294,283 (GRCm39) F63L probably benign Het
Gjc3 A G 5: 137,956,202 (GRCm39) S28P probably benign Het
Gm10250 G A 15: 5,150,473 (GRCm39) probably null Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k11 T C 19: 5,740,843 (GRCm39) L190P probably damaging Het
Mki67 T A 7: 135,298,188 (GRCm39) Q2282L probably damaging Het
Mthfd2 T A 6: 83,285,990 (GRCm39) I272F probably damaging Het
Myom1 A T 17: 71,352,750 (GRCm39) D358V probably damaging Het
Nebl T C 2: 17,395,737 (GRCm39) probably benign Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Nlrp2 T A 7: 5,325,417 (GRCm39) N14Y possibly damaging Het
Or14a258 T C 7: 86,035,514 (GRCm39) Y118C probably damaging Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pld2 T G 11: 70,445,174 (GRCm39) N591K probably benign Het
Plekha7 A G 7: 115,769,939 (GRCm39) M276T probably damaging Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Prtg A G 9: 72,716,998 (GRCm39) Y113C probably damaging Het
Rab38 T A 7: 88,099,749 (GRCm39) I88N probably damaging Het
Rbfox2 A G 15: 76,976,057 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sec14l1 A T 11: 117,047,233 (GRCm39) K637I possibly damaging Het
Sh2b1 A T 7: 126,070,620 (GRCm39) D360E possibly damaging Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Tectb G T 19: 55,170,393 (GRCm39) K81N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Tiam1 T C 16: 89,694,642 (GRCm39) M272V probably benign Het
Trav13-3 T A 14: 53,967,233 (GRCm39) noncoding transcript Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Other mutations in Klhl23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02582:Klhl23 APN 2 69,654,582 (GRCm39) missense probably damaging 1.00
IGL02637:Klhl23 APN 2 69,659,258 (GRCm39) nonsense probably null
R0128:Klhl23 UTSW 2 69,664,310 (GRCm39) missense probably damaging 0.97
R0333:Klhl23 UTSW 2 69,664,241 (GRCm39) missense probably damaging 1.00
R0538:Klhl23 UTSW 2 69,654,757 (GRCm39) missense probably benign 0.01
R1466:Klhl23 UTSW 2 69,664,232 (GRCm39) missense probably damaging 1.00
R1466:Klhl23 UTSW 2 69,664,232 (GRCm39) missense probably damaging 1.00
R1584:Klhl23 UTSW 2 69,664,232 (GRCm39) missense probably damaging 1.00
R1970:Klhl23 UTSW 2 69,664,030 (GRCm39) missense probably damaging 1.00
R2102:Klhl23 UTSW 2 69,659,228 (GRCm39) missense probably damaging 1.00
R4236:Klhl23 UTSW 2 69,654,516 (GRCm39) missense probably damaging 0.98
R4473:Klhl23 UTSW 2 69,654,151 (GRCm39) missense possibly damaging 0.67
R5446:Klhl23 UTSW 2 69,654,582 (GRCm39) missense probably damaging 1.00
R5852:Klhl23 UTSW 2 69,654,613 (GRCm39) missense probably benign 0.44
R6143:Klhl23 UTSW 2 69,664,040 (GRCm39) missense possibly damaging 0.65
R6151:Klhl23 UTSW 2 69,655,198 (GRCm39) missense probably damaging 0.99
R6277:Klhl23 UTSW 2 69,664,096 (GRCm39) missense probably damaging 1.00
R7030:Klhl23 UTSW 2 69,664,310 (GRCm39) missense probably damaging 1.00
R7303:Klhl23 UTSW 2 69,655,045 (GRCm39) missense probably benign 0.42
R7724:Klhl23 UTSW 2 69,655,056 (GRCm39) missense probably benign 0.00
R8330:Klhl23 UTSW 2 69,654,496 (GRCm39) missense probably damaging 0.98
R8913:Klhl23 UTSW 2 69,664,234 (GRCm39) missense probably damaging 1.00
R9067:Klhl23 UTSW 2 69,664,083 (GRCm39) missense possibly damaging 0.94
R9720:Klhl23 UTSW 2 69,654,804 (GRCm39) missense possibly damaging 0.78
X0066:Klhl23 UTSW 2 69,654,132 (GRCm39) start codon destroyed possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTATGACCCGGAACAGAACGAGTG -3'
(R):5'- TTCAGATCCCTGCCAGCTAGAGAC -3'

Sequencing Primer
(F):5'- CGCCTATGATGGAAAGGAGGATG -3'
(R):5'- atctgcctgcctctgcc -3'
Posted On 2013-06-12