Incidental Mutation 'R5363:Zbtb17'
ID 500974
Institutional Source Beutler Lab
Gene Symbol Zbtb17
Ensembl Gene ENSMUSG00000006215
Gene Name zinc finger and BTB domain containing 17
Synonyms mZ13, Zfp100, Miz1
MMRRC Submission 042941-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 141171984-141195248 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141194072 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 700 (E700G)
Ref Sequence ENSEMBL: ENSMUSP00000006377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold Q60821
Predicted Effect probably benign
Transcript: ENSMUST00000006377
AA Change: E700G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215
AA Change: E700G

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078886
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147227
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in the regulation of c-myc. The symbol MIZ1 has also been associated with PIAS2 which is a different gene located on chromosome 18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryonic development of homozygous null mice is severely impaired and death occurs prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,132,963 (GRCm39) I40T probably benign Het
Abca13 T C 11: 9,227,035 (GRCm39) V597A possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anapc1 A G 2: 128,492,114 (GRCm39) probably null Het
Ap4e1 G A 2: 126,879,784 (GRCm39) probably null Het
Apod T C 16: 31,129,909 (GRCm39) T16A probably benign Het
Arrdc5 C T 17: 56,607,138 (GRCm39) V36M probably damaging Het
Bcan A G 3: 87,902,794 (GRCm39) V328A probably damaging Het
Bche A G 3: 73,607,972 (GRCm39) Y485H probably damaging Het
Btbd6 A G 12: 112,941,756 (GRCm39) Y356C probably damaging Het
Cdh4 A G 2: 179,528,556 (GRCm39) T555A probably benign Het
Ciita C T 16: 10,330,031 (GRCm39) H769Y probably damaging Het
Clspn A G 4: 126,455,579 (GRCm39) D35G possibly damaging Het
Cpsf3 T A 12: 21,358,986 (GRCm39) M562K probably benign Het
Cstdc1 G T 2: 148,625,298 (GRCm39) L77F probably damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,759,803 (GRCm39) probably null Het
Cyp2a22 T A 7: 26,635,858 (GRCm39) Q235L probably damaging Het
Dicer1 A G 12: 104,669,410 (GRCm39) S1091P probably damaging Het
Dync1li1 T A 9: 114,544,297 (GRCm39) I323N probably damaging Het
Fat4 A G 3: 38,942,154 (GRCm39) N349S probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Hectd4 T C 5: 121,448,666 (GRCm39) M338T probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Lactb2 A T 1: 13,700,356 (GRCm39) I225N probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mrps30 A G 13: 118,523,698 (GRCm39) S25P probably benign Het
Myg1 T C 15: 102,246,259 (GRCm39) V378A probably benign Het
Notch4 C T 17: 34,806,097 (GRCm39) T1731I probably damaging Het
Ntmt1 A G 2: 30,710,660 (GRCm39) D121G probably damaging Het
Or10p21 C A 10: 128,847,783 (GRCm39) P210T probably damaging Het
Or5d39 A T 2: 87,980,146 (GRCm39) D72E probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pclo A G 5: 14,719,424 (GRCm39) D1187G unknown Het
Pkd1 T A 17: 24,784,047 (GRCm39) Y198N probably benign Het
Plk4 T A 3: 40,756,419 (GRCm39) N83K possibly damaging Het
Prune2 A T 19: 17,095,630 (GRCm39) Q378L probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rasa1 G T 13: 85,436,674 (GRCm39) T118K possibly damaging Het
Rin3 G A 12: 102,292,093 (GRCm39) V97M probably damaging Het
Rock2 T C 12: 17,015,655 (GRCm39) probably null Het
Slc34a1 A G 13: 55,551,081 (GRCm39) I289V probably benign Het
Slc34a1 T C 13: 55,560,103 (GRCm39) L443P probably damaging Het
Slco2a1 A T 9: 102,947,462 (GRCm39) I254F probably damaging Het
Spink11 T C 18: 44,328,753 (GRCm39) I32V probably benign Het
Spire1 T C 18: 67,639,625 (GRCm39) E296G probably damaging Het
Sun1 A G 5: 139,220,498 (GRCm39) N410D probably damaging Het
Syt14 T A 1: 192,612,971 (GRCm39) T610S possibly damaging Het
Tenm3 T C 8: 48,740,866 (GRCm39) I1206V possibly damaging Het
Tet3 A T 6: 83,353,746 (GRCm39) probably null Het
Thbs1 A T 2: 117,953,147 (GRCm39) Q919L probably damaging Het
Trappc10 A G 10: 78,024,674 (GRCm39) F1152L possibly damaging Het
Trp63 C A 16: 25,682,468 (GRCm39) N176K probably damaging Het
Zfp446 G A 7: 12,711,984 (GRCm39) R69H probably benign Het
Zfy2 C T Y: 2,106,555 (GRCm39) C693Y possibly damaging Het
Zxdc A G 6: 90,359,128 (GRCm39) T587A probably damaging Het
Zyg11a A G 4: 108,046,819 (GRCm39) C552R probably damaging Het
Other mutations in Zbtb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Zbtb17 APN 4 141,193,678 (GRCm39) nonsense probably null
IGL01449:Zbtb17 APN 4 141,190,616 (GRCm39) missense probably benign
IGL01835:Zbtb17 APN 4 141,192,749 (GRCm39) critical splice donor site probably null
IGL02141:Zbtb17 APN 4 141,192,264 (GRCm39) missense probably damaging 1.00
IGL02142:Zbtb17 APN 4 141,192,293 (GRCm39) missense probably benign 0.29
IGL02167:Zbtb17 APN 4 141,189,140 (GRCm39) missense possibly damaging 0.94
IGL02388:Zbtb17 APN 4 141,189,224 (GRCm39) missense probably damaging 1.00
IGL02600:Zbtb17 APN 4 141,194,196 (GRCm39) missense possibly damaging 0.50
IGL02617:Zbtb17 APN 4 141,192,399 (GRCm39) missense probably damaging 0.97
IGL03290:Zbtb17 APN 4 141,194,244 (GRCm39) missense probably damaging 1.00
IGL03391:Zbtb17 APN 4 141,194,069 (GRCm39) missense probably damaging 1.00
IGL02799:Zbtb17 UTSW 4 141,190,691 (GRCm39) missense probably benign 0.20
R0698:Zbtb17 UTSW 4 141,193,407 (GRCm39) splice site probably null
R0736:Zbtb17 UTSW 4 141,189,097 (GRCm39) missense probably damaging 1.00
R1924:Zbtb17 UTSW 4 141,191,914 (GRCm39) missense probably damaging 1.00
R1940:Zbtb17 UTSW 4 141,192,859 (GRCm39) missense possibly damaging 0.83
R2164:Zbtb17 UTSW 4 141,191,557 (GRCm39) missense probably benign
R2517:Zbtb17 UTSW 4 141,191,896 (GRCm39) missense probably damaging 1.00
R3424:Zbtb17 UTSW 4 141,192,299 (GRCm39) missense probably damaging 0.99
R3884:Zbtb17 UTSW 4 141,191,886 (GRCm39) missense probably damaging 1.00
R4609:Zbtb17 UTSW 4 141,193,809 (GRCm39) missense probably damaging 1.00
R5055:Zbtb17 UTSW 4 141,193,860 (GRCm39) missense possibly damaging 0.68
R5327:Zbtb17 UTSW 4 141,192,942 (GRCm39) missense probably benign 0.22
R5987:Zbtb17 UTSW 4 141,192,128 (GRCm39) missense possibly damaging 0.94
R6038:Zbtb17 UTSW 4 141,191,752 (GRCm39) missense probably benign 0.05
R6038:Zbtb17 UTSW 4 141,191,752 (GRCm39) missense probably benign 0.05
R6311:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6320:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6321:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6322:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6337:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6365:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6492:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6605:Zbtb17 UTSW 4 141,192,261 (GRCm39) missense probably damaging 0.99
R6695:Zbtb17 UTSW 4 141,189,110 (GRCm39) missense probably damaging 1.00
R7717:Zbtb17 UTSW 4 141,193,394 (GRCm39) missense probably damaging 1.00
R7999:Zbtb17 UTSW 4 141,189,134 (GRCm39) missense probably damaging 1.00
R8542:Zbtb17 UTSW 4 141,194,139 (GRCm39) unclassified probably benign
R8544:Zbtb17 UTSW 4 141,194,139 (GRCm39) unclassified probably benign
R8545:Zbtb17 UTSW 4 141,194,139 (GRCm39) unclassified probably benign
R8836:Zbtb17 UTSW 4 141,189,233 (GRCm39) missense possibly damaging 0.68
R9072:Zbtb17 UTSW 4 141,193,676 (GRCm39) missense possibly damaging 0.50
R9073:Zbtb17 UTSW 4 141,193,676 (GRCm39) missense possibly damaging 0.50
R9389:Zbtb17 UTSW 4 141,193,131 (GRCm39) missense possibly damaging 0.89
R9785:Zbtb17 UTSW 4 141,194,271 (GRCm39) missense possibly damaging 0.64
Z1176:Zbtb17 UTSW 4 141,190,990 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACAGGTGTGCACTGTGG -3'
(R):5'- TGGAACATGACCAGTGCCTG -3'

Sequencing Primer
(F):5'- TGTGCACTGTGGGCAGG -3'
(R):5'- GGGCTGTGTGGATCCGAAC -3'
Posted On 2017-12-01