Incidental Mutation 'R5363:Dync1li1'
ID 500976
Institutional Source Beutler Lab
Gene Symbol Dync1li1
Ensembl Gene ENSMUSG00000032435
Gene Name dynein cytoplasmic 1 light intermediate chain 1
Synonyms Dnclic1, 1110053F02Rik, LIC-1
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.686) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 114688790-114724302 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114715229 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 323 (I323N)
Ref Sequence ENSEMBL: ENSMUSP00000035366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047404]
AlphaFold Q8R1Q8
Predicted Effect probably damaging
Transcript: ENSMUST00000047404
AA Change: I323N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035366
Gene: ENSMUSG00000032435
AA Change: I323N

DomainStartEndE-ValueType
Pfam:DLIC 43 519 2.7e-258 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to light intermediate subunit family, whose members are components of the multiprotein cytoplasmic dynein complex, which is involved in intracellular trafficking and chromosome segregation during mitosis. The protein plays a role in moving the spindle assembly checkpoint (SAC) from kinetochores to spindle poles. The protein may also mediate binding to other cargo molecules to facilitate intracellular vesicle trafficking. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit increased anxiety-related response, increased dendrite length, increased neuron migration, and decreased lysosome trafficking. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Dync1li1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Dync1li1 APN 9 114720597 missense possibly damaging 0.89
R1510:Dync1li1 UTSW 9 114689210 missense possibly damaging 0.59
R1824:Dync1li1 UTSW 9 114709184 missense probably benign 0.01
R1955:Dync1li1 UTSW 9 114721746 missense probably damaging 0.99
R2000:Dync1li1 UTSW 9 114713563 missense probably benign 0.05
R2520:Dync1li1 UTSW 9 114689006 missense probably null 0.17
R2912:Dync1li1 UTSW 9 114715675 missense probably benign 0.31
R4418:Dync1li1 UTSW 9 114706170 missense probably damaging 1.00
R4422:Dync1li1 UTSW 9 114709309 missense probably damaging 1.00
R4646:Dync1li1 UTSW 9 114709169 missense probably damaging 0.96
R4693:Dync1li1 UTSW 9 114706098 missense probably damaging 0.99
R4817:Dync1li1 UTSW 9 114705094 missense probably benign 0.09
R5027:Dync1li1 UTSW 9 114713544 missense probably damaging 1.00
R5274:Dync1li1 UTSW 9 114715205 missense possibly damaging 0.84
R5902:Dync1li1 UTSW 9 114717861 critical splice acceptor site probably null
R6359:Dync1li1 UTSW 9 114713570 missense probably benign 0.29
R7235:Dync1li1 UTSW 9 114715163 missense possibly damaging 0.58
R7757:Dync1li1 UTSW 9 114709277 missense possibly damaging 0.65
R8161:Dync1li1 UTSW 9 114706183 missense probably damaging 1.00
R8191:Dync1li1 UTSW 9 114709185 missense probably benign 0.02
R8703:Dync1li1 UTSW 9 114723261 missense probably damaging 0.98
R8733:Dync1li1 UTSW 9 114705110 missense probably damaging 0.97
R9211:Dync1li1 UTSW 9 114688944 nonsense probably null
R9307:Dync1li1 UTSW 9 114706008 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGAAAATGTGGTCTCTGATGC -3'
(R):5'- ACTAGGTACAGCGCTTACGG -3'

Sequencing Primer
(F):5'- AAAATGTGGTCTCTGATGCCTTTATG -3'
(R):5'- TGTCCAGTGCCATCTCAA -3'
Posted On 2017-12-01