Mutagenetix > Incidental Mutations

Incidental Mutation 'R5363:Spire1'

500977

Institutional Source

Beutler Lab

Gene Symbol

Spire1

Ensembl Gene

ENSMUSG00000024533

Gene Name

spire type actin nucleation factor 1

Synonyms

6030430B19Rik, Spir-1

MMRRC Submission

042941-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.242) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67488209-67610790 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67506555 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 296 (E296G)

Ref Sequence

ENSEMBL: ENSMUSP00000049336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]

Predicted Effect

probably damaging
Transcript: ENSMUST00000045105
AA Change: E296G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: E296G

Domain	Start	End	E-Value	Type
Pfam:KIND	1	78	3.3e-27	PFAM
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	289	316	N/A	INTRINSIC
low complexity region	339	350	N/A	INTRINSIC
SCOP:d1zbdb_	445	518	1e-7	SMART
low complexity region	596	606	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082243
AA Change: E309G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: E309G

Domain	Start	End	E-Value	Type
Blast:KIND	1	73	2e-26	BLAST
PDB:3RBW\|D	1	79	3e-28	PDB
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	302	329	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
SCOP:d1zbdb_	400	473	2e-7	SMART
low complexity region	551	561	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115050
AA Change: E309G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: E309G

Domain	Start	End	E-Value	Type
PDB:4EFH\|B	106	162	9e-6	PDB
low complexity region	219	246	N/A	INTRINSIC
low complexity region	269	280	N/A	INTRINSIC
SCOP:d1zbdb_	317	390	4e-7	SMART
low complexity region	468	478	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224122

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224799
AA Change: E226G

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Spire1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Spire1	APN	18	67529015	missense	probably damaging	1.00
IGL01639:Spire1	APN	18	67545668	missense	possibly damaging	0.74
IGL02334:Spire1	APN	18	67506655	missense	probably benign	0.00
PIT4677001:Spire1	UTSW	18	67491365	missense	probably damaging	1.00
R0457:Spire1	UTSW	18	67552600	missense	probably damaging	0.98
R0531:Spire1	UTSW	18	67491305	missense	probably damaging	1.00
R0608:Spire1	UTSW	18	67528875	missense	probably damaging	0.99
R2098:Spire1	UTSW	18	67503466	missense	probably damaging	0.99
R2299:Spire1	UTSW	18	67530423	missense	probably damaging	1.00
R3028:Spire1	UTSW	18	67491347	missense	probably damaging	1.00
R3815:Spire1	UTSW	18	67506663	missense	probably benign	0.05
R4049:Spire1	UTSW	18	67529031	splice site	probably null
R4050:Spire1	UTSW	18	67529031	splice site	probably null
R4059:Spire1	UTSW	18	67545713	missense	probably damaging	0.98
R4109:Spire1	UTSW	18	67497217	missense	probably damaging	1.00
R4700:Spire1	UTSW	18	67512865	missense	probably benign	0.01
R4941:Spire1	UTSW	18	67519314	missense	possibly damaging	0.54
R4995:Spire1	UTSW	18	67552779	unclassified	probably null
R5561:Spire1	UTSW	18	67506646	missense	probably damaging	0.96
R5795:Spire1	UTSW	18	67495195	missense	probably benign
R5952:Spire1	UTSW	18	67506709	missense	probably benign	0.00
R5982:Spire1	UTSW	18	67497316	critical splice acceptor site	probably null
R7388:Spire1	UTSW	18	67519880	missense	probably damaging	1.00
R7559:Spire1	UTSW	18	67501117	missense	probably benign	0.04
R8006:Spire1	UTSW	18	67501181	nonsense	probably null
T0970:Spire1	UTSW	18	67501063	splice site	probably null
Z1088:Spire1	UTSW	18	67495152	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TTCTAAGCCTACCCACCACTGG -3'
(R):5'- CAGATTACCTCTCCTGGCTCAAG -3'

Sequencing Primer
(F):5'- CACCACTGGCCTGTAGTAAG -3'
(R):5'- TCTCCTGGCTCAAGAAAAGG -3'

Posted On

2017-12-01