Incidental Mutation 'R5365:Gpc2'
ID500978
Institutional Source Beutler Lab
Gene Symbol Gpc2
Ensembl Gene ENSMUSG00000029510
Gene Nameglypican 2 (cerebroglycan)
Synonyms
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138273655-138280005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138275623 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 438 (Y438H)
Ref Sequence ENSEMBL: ENSMUSP00000124459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014089] [ENSMUST00000048028] [ENSMUST00000100530] [ENSMUST00000159067] [ENSMUST00000160729] [ENSMUST00000161279] [ENSMUST00000161647] [ENSMUST00000161665] [ENSMUST00000161691] [ENSMUST00000161827] [ENSMUST00000161984] [ENSMUST00000162245]
Predicted Effect probably damaging
Transcript: ENSMUST00000014089
AA Change: Y438H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014089
Gene: ENSMUSG00000029510
AA Change: Y438H

DomainStartEndE-ValueType
Pfam:Glypican 7 560 2.8e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048028
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100530
SMART Domains Protein: ENSMUSP00000098099
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159689
Predicted Effect probably benign
Transcript: ENSMUST00000160729
SMART Domains Protein: ENSMUSP00000124170
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161113
Predicted Effect probably benign
Transcript: ENSMUST00000161279
SMART Domains Protein: ENSMUSP00000124841
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161647
SMART Domains Protein: ENSMUSP00000125084
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 4 226 5.3e-58 PFAM
Pfam:Gal-3-0_sulfotr 265 458 3.8e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161665
SMART Domains Protein: ENSMUSP00000124682
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161691
SMART Domains Protein: ENSMUSP00000125290
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161827
AA Change: Y438H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124459
Gene: ENSMUSG00000029510
AA Change: Y438H

DomainStartEndE-ValueType
Pfam:Glypican 11 566 3.1e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161984
SMART Domains Protein: ENSMUSP00000137879
Gene: ENSMUSG00000029510

DomainStartEndE-ValueType
Pfam:Glypican 7 342 3.7e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162245
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162909
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Gpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Gpc2 APN 5 138274309 utr 3 prime probably benign
IGL00938:Gpc2 APN 5 138278907 missense probably benign 0.08
IGL01315:Gpc2 APN 5 138276039 missense probably benign 0.00
IGL01583:Gpc2 APN 5 138275530 missense probably damaging 1.00
IGL01590:Gpc2 APN 5 138274378 missense probably damaging 0.99
IGL02040:Gpc2 APN 5 138276582 critical splice donor site probably null
IGL02322:Gpc2 APN 5 138276237 unclassified probably null
IGL02655:Gpc2 APN 5 138278925 missense possibly damaging 0.73
R0638:Gpc2 UTSW 5 138278534 missense possibly damaging 0.79
R1004:Gpc2 UTSW 5 138278225 missense probably damaging 1.00
R1918:Gpc2 UTSW 5 138278379 missense probably benign 0.01
R4177:Gpc2 UTSW 5 138277359 unclassified probably benign
R4361:Gpc2 UTSW 5 138278290 nonsense probably null
R5178:Gpc2 UTSW 5 138275605 missense possibly damaging 0.59
R5250:Gpc2 UTSW 5 138278968 missense probably damaging 1.00
R6182:Gpc2 UTSW 5 138278414 missense probably benign 0.01
R6548:Gpc2 UTSW 5 138277271 intron probably null
R6985:Gpc2 UTSW 5 138278408 missense probably damaging 1.00
R7064:Gpc2 UTSW 5 138278910 missense probably damaging 1.00
R7821:Gpc2 UTSW 5 138276297 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACTTGGGAAGCAATGGACC -3'
(R):5'- CTGCCTGTAACCGTATGTGG -3'

Sequencing Primer
(F):5'- CAGAGTGAGTTTCTGAGCCTCAC -3'
(R):5'- TAACCGTATGTGGGGACTCC -3'
Posted On2017-12-01