Incidental Mutation 'R5334:Col24a1'
ID 500986
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5334 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 145167280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 1119 (P1119Q)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848]
AlphaFold Q30D77
Predicted Effect possibly damaging
Transcript: ENSMUST00000029848
AA Change: P1119Q

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: P1119Q

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc15 C T 7: 101,547,810 (GRCm39) P68L probably damaging Het
Ap4s1 C T 12: 51,785,454 (GRCm39) S142L probably benign Het
Apol11a A G 15: 77,400,953 (GRCm39) T147A probably benign Het
Aqp9 T C 9: 71,030,292 (GRCm39) probably null Het
Arhgap25 T A 6: 87,440,243 (GRCm39) N468I possibly damaging Het
Arhgef2 T A 3: 88,553,636 (GRCm39) S924R probably damaging Het
Atad3a A T 4: 155,840,146 (GRCm39) L144Q probably damaging Het
Ccbe1 T C 18: 66,216,316 (GRCm39) I136V probably damaging Het
Dgkd T C 1: 87,865,989 (GRCm39) probably null Het
Dnah7a A G 1: 53,542,805 (GRCm39) I2455T probably benign Het
Dock2 T C 11: 34,178,643 (GRCm39) T1795A probably benign Het
Dpp6 A T 5: 27,914,538 (GRCm39) E541V probably benign Het
Edem1 T C 6: 108,825,793 (GRCm39) probably null Het
Fbxo41 A G 6: 85,455,465 (GRCm39) V573A probably damaging Het
Fech A C 18: 64,597,191 (GRCm39) V256G probably damaging Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gal3st4 T G 5: 138,263,983 (GRCm39) K339Q probably benign Het
Gpr158 T A 2: 21,832,316 (GRCm39) S1139T probably benign Het
Gpr180 A T 14: 118,397,468 (GRCm39) S321C probably damaging Het
Grik1 CGG CGGG 16: 87,720,082 (GRCm39) probably null Het
Grin2c T G 11: 115,146,881 (GRCm39) N438T possibly damaging Het
Hcn2 T C 10: 79,562,125 (GRCm39) S374P probably damaging Het
Hmcn1 T A 1: 150,631,123 (GRCm39) I892F probably damaging Het
Ifi207 C T 1: 173,555,097 (GRCm39) V869I probably benign Het
Itgad T C 7: 127,788,458 (GRCm39) Y390H probably damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kcnj15 A G 16: 95,097,508 (GRCm39) K377E probably damaging Het
Kcnq3 A G 15: 65,897,073 (GRCm39) S276P probably damaging Het
Klhl26 T C 8: 70,904,968 (GRCm39) D280G probably damaging Het
Lmnb2 C T 10: 80,739,791 (GRCm39) V376I probably benign Het
Lrrc37 T C 11: 103,504,699 (GRCm39) Q2423R probably benign Het
Mepce T A 5: 137,784,889 (GRCm39) R29S probably benign Het
Mlh3 A G 12: 85,292,535 (GRCm39) probably null Het
Mlip T A 9: 77,150,958 (GRCm39) T33S probably damaging Het
Msantd5f6 T A 4: 73,321,754 (GRCm39) M94L probably benign Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Ncapg2 T C 12: 116,390,257 (GRCm39) I402T probably damaging Het
Or2aj6 C G 16: 19,443,241 (GRCm39) G203A probably benign Het
Or5m13b T C 2: 85,754,058 (GRCm39) Y149H probably damaging Het
Pcsk5 T C 19: 17,439,215 (GRCm39) D1301G probably benign Het
Pilrb1 T C 5: 137,853,165 (GRCm39) M213V probably benign Het
Plxdc1 T C 11: 97,846,931 (GRCm39) T163A possibly damaging Het
Pnpla2 T C 7: 141,039,406 (GRCm39) L373P probably damaging Het
Prickle2 A G 6: 92,402,665 (GRCm39) Y52H probably damaging Het
Rnf220 A G 4: 117,129,548 (GRCm39) C294R probably damaging Het
Slc12a1 A G 2: 125,059,809 (GRCm39) D903G probably damaging Het
Slc34a1 T C 13: 24,003,034 (GRCm39) F228S probably damaging Het
Sptbn1 T C 11: 30,087,364 (GRCm39) E1025G possibly damaging Het
Sult1c2 T G 17: 54,271,758 (GRCm39) D143A probably damaging Het
Taar1 T G 10: 23,796,443 (GRCm39) I47R probably damaging Het
Tctn3 G T 19: 40,591,266 (GRCm39) Q514K probably benign Het
Tg T C 15: 66,549,904 (GRCm39) F222S probably damaging Het
Tmem236 C A 2: 14,223,871 (GRCm39) T220K possibly damaging Het
Trim50 C T 5: 135,396,330 (GRCm39) T426M probably damaging Het
Vmn1r237 T C 17: 21,534,942 (GRCm39) F222L probably benign Het
Wrap73 G A 4: 154,229,731 (GRCm39) R34Q probably damaging Het
Zfp85 T C 13: 67,899,803 (GRCm39) Y52C probably damaging Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCTGAGAATGACTGACACTTTG -3'
(R):5'- TGTCAGTGTCTGTGCCCATG -3'

Sequencing Primer
(F):5'- AACTCACTTTGTAGGCCAGG -3'
(R):5'- CCATGCCTGCCTTGTGTGTG -3'
Posted On 2017-12-01