Mutagenetix > Incidental Mutation

Incidental Mutation 'R5334:Col24a1'

500986

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5334 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 145461525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 1119 (P1119Q)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029848
AA Change: P1119Q

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: P1119Q

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Ap4s1	C	T	12: 51,738,671	S142L	probably benign	Het
Apol11a	A	G	15: 77,516,753	T147A	probably benign	Het
Aqp9	T	C	9: 71,123,010		probably null	Het
Arhgap25	T	A	6: 87,463,261	N468I	possibly damaging	Het
Arhgef2	T	A	3: 88,646,329	S924R	probably damaging	Het
Atad3a	A	T	4: 155,755,689	L144Q	probably damaging	Het
Ccbe1	T	C	18: 66,083,245	I136V	probably damaging	Het
Dgkd	T	C	1: 87,938,267		probably null	Het
Dnah7a	A	G	1: 53,503,646	I2455T	probably benign	Het
Dock2	T	C	11: 34,228,643	T1795A	probably benign	Het
Dpp6	A	T	5: 27,709,540	E541V	probably benign	Het
Edem1	T	C	6: 108,848,832		probably null	Het
Fbxo41	A	G	6: 85,478,483	V573A	probably damaging	Het
Fech	A	C	18: 64,464,120	V256G	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gal3st4	T	G	5: 138,265,721	K339Q	probably benign	Het
Gm11487	T	A	4: 73,403,517	M94L	probably benign	Het
Gm884	T	C	11: 103,613,873	Q2423R	probably benign	Het
Gpr158	T	A	2: 21,827,505	S1139T	probably benign	Het
Gpr180	A	T	14: 118,160,056	S321C	probably damaging	Het
Grik1	CGG	CGGG	16: 87,923,194		probably null	Het
Grin2c	T	G	11: 115,256,055	N438T	possibly damaging	Het
Hcn2	T	C	10: 79,726,291	S374P	probably damaging	Het
Hmcn1	T	A	1: 150,755,372	I892F	probably damaging	Het
Ifi207	C	T	1: 173,727,531	V869I	probably benign	Het
Itgad	T	C	7: 128,189,286	Y390H	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnj15	A	G	16: 95,296,649	K377E	probably damaging	Het
Kcnq3	A	G	15: 66,025,224	S276P	probably damaging	Het
Klhl26	T	C	8: 70,452,318	D280G	probably damaging	Het
Lmnb2	C	T	10: 80,903,957	V376I	probably benign	Het
Mepce	T	A	5: 137,786,627	R29S	probably benign	Het
Mlh3	A	G	12: 85,245,761		probably null	Het
Mlip	T	A	9: 77,243,676	T33S	probably damaging	Het
Mtpn	C	T	6: 35,512,290	D100N	probably benign	Het
Ncapg2	T	C	12: 116,426,637	I402T	probably damaging	Het
Olfr1026	T	C	2: 85,923,714	Y149H	probably damaging	Het
Olfr171	C	G	16: 19,624,491	G203A	probably benign	Het
Pcsk5	T	C	19: 17,461,851	D1301G	probably benign	Het
Pilrb1	T	C	5: 137,854,903	M213V	probably benign	Het
Plxdc1	T	C	11: 97,956,105	T163A	possibly damaging	Het
Pnpla2	T	C	7: 141,459,493	L373P	probably damaging	Het
Prickle2	A	G	6: 92,425,684	Y52H	probably damaging	Het
Rnf220	A	G	4: 117,272,351	C294R	probably damaging	Het
Slc12a1	A	G	2: 125,217,889	D903G	probably damaging	Het
Slc17a2	T	C	13: 23,819,051	F228S	probably damaging	Het
Sptbn1	T	C	11: 30,137,364	E1025G	possibly damaging	Het
Sult1c1	T	G	17: 53,964,730	D143A	probably damaging	Het
Taar1	T	G	10: 23,920,545	I47R	probably damaging	Het
Tctn3	G	T	19: 40,602,822	Q514K	probably benign	Het
Tg	T	C	15: 66,678,055	F222S	probably damaging	Het
Tmem236	C	A	2: 14,219,060	T220K	possibly damaging	Het
Trim50	C	T	5: 135,367,476	T426M	probably damaging	Het
Vmn1r237	T	C	17: 21,314,680	F222L	probably benign	Het
Wrap73	G	A	4: 154,145,274	R34Q	probably damaging	Het
Zfp85	T	C	13: 67,751,684	Y52C	probably damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATCCTGAGAATGACTGACACTTTG -3'
(R):5'- TGTCAGTGTCTGTGCCCATG -3'

Sequencing Primer
(F):5'- AACTCACTTTGTAGGCCAGG -3'
(R):5'- CCATGCCTGCCTTGTGTGTG -3'

Posted On

2017-12-01