Incidental Mutation 'R5380:Fbxo25'
ID500987
Institutional Source Beutler Lab
Gene Symbol Fbxo25
Ensembl Gene ENSMUSG00000038365
Gene NameF-box protein 25
Synonyms9130015I06Rik, Fbx25
MMRRC Submission 042955-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R5380 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13907803-13940522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13921886 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 79 (S79R)
Ref Sequence ENSEMBL: ENSMUSP00000039544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043520] [ENSMUST00000209913]
Predicted Effect probably benign
Transcript: ENSMUST00000043520
AA Change: S79R

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039544
Gene: ENSMUSG00000038365
AA Change: S79R

DomainStartEndE-ValueType
low complexity region 209 222 N/A INTRINSIC
Blast:FBOX 230 271 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209913
AA Change: S79R

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik A T 4: 144,423,802 W70R probably damaging Het
Aco1 A T 4: 40,177,848 I290F probably damaging Het
Cmip T A 8: 117,422,890 C155S probably damaging Het
Cyba G T 8: 122,426,979 P82T possibly damaging Het
Dgkb C T 12: 38,127,300 R202W possibly damaging Het
Dnah6 T C 6: 73,037,615 E3611G probably damaging Het
Dnah7b A T 1: 46,217,191 S1885C probably benign Het
Dopey2 A G 16: 93,763,410 E748G probably damaging Het
Dusp18 C A 11: 3,897,037 P9Q probably damaging Het
Fat4 T A 3: 38,888,864 D635E probably damaging Het
Fgfr4 T A 13: 55,167,417 L675Q probably damaging Het
Foxo1 T A 3: 52,269,025 L75Q probably damaging Het
Fsip2 T C 2: 82,975,398 V687A possibly damaging Het
Gga3 G T 11: 115,588,431 P354Q probably damaging Het
Gm11077 A T 6: 140,729,322 K13N unknown Het
Haus4 T A 14: 54,549,775 K75M probably damaging Het
Igfn1 G A 1: 135,966,087 T2085M probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lims1 A T 10: 58,416,670 I321L probably damaging Het
Ms4a6b A T 19: 11,521,680 I53F probably damaging Het
Msl3l2 A G 10: 56,115,572 D131G probably damaging Het
Nrap A G 19: 56,381,603 V189A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pfkl T G 10: 77,997,589 I260L possibly damaging Het
Pkd2l1 A G 19: 44,157,732 Y128H probably benign Het
Prpf6 T A 2: 181,608,266 L73Q probably damaging Het
R3hdm2 T C 10: 127,485,447 V658A probably damaging Het
Rab27b T C 18: 69,996,155 T23A probably damaging Het
Rabif A G 1: 134,506,242 E98G probably damaging Het
Ror2 T C 13: 53,117,149 D378G possibly damaging Het
Spata21 A G 4: 141,107,185 T494A probably damaging Het
Ssh2 A G 11: 77,453,945 K919E probably benign Het
Tnrc6b C G 15: 80,879,565 P423A possibly damaging Het
Tomm40 A G 7: 19,701,750 F352L probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Tspo2 A G 17: 48,448,752 F93L probably benign Het
V1ra8 T A 6: 90,203,022 I69K probably damaging Het
Zan T C 5: 137,457,840 T1353A unknown Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp281 A G 1: 136,625,938 K218R possibly damaging Het
Other mutations in Fbxo25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Fbxo25 APN 8 13923922 unclassified probably benign
IGL03087:Fbxo25 APN 8 13924019 critical splice donor site probably null
IGL03112:Fbxo25 APN 8 13921034 missense probably benign 0.18
IGL03403:Fbxo25 APN 8 13929423 missense probably benign 0.00
R0720:Fbxo25 UTSW 8 13935222 missense probably damaging 1.00
R0755:Fbxo25 UTSW 8 13935219 missense probably benign 0.00
R1865:Fbxo25 UTSW 8 13935248 missense probably damaging 1.00
R2043:Fbxo25 UTSW 8 13921905 missense probably damaging 0.99
R4213:Fbxo25 UTSW 8 13939581 missense probably damaging 1.00
R4248:Fbxo25 UTSW 8 13939617 missense probably damaging 1.00
R7450:Fbxo25 UTSW 8 13931235 missense probably benign 0.09
R8264:Fbxo25 UTSW 8 13929393 missense possibly damaging 0.89
R8409:Fbxo25 UTSW 8 13914999 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGACAGGAGTCTAAGTACTTCC -3'
(R):5'- GCATTTGTGGTGACCTCATG -3'

Sequencing Primer
(F):5'- TTCCATGATATTAGGGAATAAAGTGC -3'
(R):5'- TAACATGACTAATCCCTGTGGC -3'
Posted On2017-12-01