Incidental Mutation 'R5338:Slc35d2'
ID500995
Institutional Source Beutler Lab
Gene Symbol Slc35d2
Ensembl Gene ENSMUSG00000033114
Gene Namesolute carrier family 35, member D2
SynonymsSQV7L, UGTrel8, 5730408I21Rik, hfrc
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5338 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location64096308-64129368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64097682 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 294 (M294K)
Ref Sequence ENSEMBL: ENSMUSP00000097040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099441] [ENSMUST00000220792] [ENSMUST00000222794] [ENSMUST00000223461]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099441
AA Change: M294K

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097040
Gene: ENSMUSG00000033114
AA Change: M294K

DomainStartEndE-ValueType
Pfam:TPT 12 301 4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220792
AA Change: H266Q

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222692
Predicted Effect probably benign
Transcript: ENSMUST00000222794
Predicted Effect probably benign
Transcript: ENSMUST00000223461
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleotide sugars, which are synthesized in the cytosol or the nucleus, are high-energy donor substrates for glycosyltransferases located in the lumen of the endoplasmic reticulum and Golgi apparatus. Translocation of nucleotide sugars from the cytosol into the lumen compartment is mediated by specific nucleotide sugar transporters, such as SLC35D2 (Suda et al., 2004 [PubMed 15082721]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T A 9: 99,620,544 N252K probably damaging Het
Abhd16a A G 17: 35,094,302 E132G probably damaging Het
Adgrv1 G A 13: 81,529,046 R1889W possibly damaging Het
Aftph A T 11: 20,727,203 D135E probably benign Het
Arf1 A C 11: 59,213,215 F63V probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
B3gnt7 T A 1: 86,305,644 F87Y probably damaging Het
Bcat1 A G 6: 145,007,627 Y345H possibly damaging Het
Birc3 G T 9: 7,857,359 T371K probably benign Het
Ccdc175 A T 12: 72,184,971 S5T probably damaging Het
Ccdc186 A T 19: 56,813,257 S143T possibly damaging Het
Cct6b A T 11: 82,762,189 M28K possibly damaging Het
Cers4 C A 8: 4,515,680 A42D probably damaging Het
Crmp1 G T 5: 37,279,674 V236L probably benign Het
Ctdspl2 T A 2: 121,981,312 N212K probably benign Het
Dclk3 T C 9: 111,469,059 V557A possibly damaging Het
Dnmt1 A T 9: 20,952,719 H23Q probably benign Het
Dpp8 G T 9: 65,063,924 E609* probably null Het
Dtx3 C A 10: 127,193,050 M106I probably benign Het
Ero1lb A C 13: 12,574,851 D45A probably damaging Het
Fcho2 T A 13: 98,730,891 D688V probably damaging Het
Fhod3 A T 18: 25,028,081 S557C probably damaging Het
Flnc T C 6: 29,444,064 S626P possibly damaging Het
Foxi3 G T 6: 70,960,618 G278V probably damaging Het
Gbp10 A G 5: 105,224,300 L198P probably damaging Het
Gcn1l1 A G 5: 115,583,403 T458A probably benign Het
Gigyf1 C T 5: 137,523,160 probably benign Het
Gtpbp2 A C 17: 46,167,834 T526P probably damaging Het
Gys2 A G 6: 142,454,513 L324S probably damaging Het
Hpn C A 7: 31,103,356 V119L probably benign Het
Ino80d C A 1: 63,058,939 V599L probably benign Het
Kcnh3 G T 15: 99,242,394 G1054* probably null Het
Maml1 A T 11: 50,266,951 D132E probably benign Het
Mastl A T 2: 23,133,491 S407T probably benign Het
Mettl1 T C 10: 127,043,085 W3R probably damaging Het
Mprip A G 11: 59,760,573 Y1701C probably damaging Het
Mylk3 T C 8: 85,342,721 N484D probably damaging Het
Nod2 G A 8: 88,672,785 probably null Het
Nrde2 A T 12: 100,130,778 F921Y probably damaging Het
Nup88 G T 11: 70,944,908 T575N probably damaging Het
Nxpe3 T C 16: 55,866,343 T101A possibly damaging Het
Olfr1214 C T 2: 88,987,465 V246I possibly damaging Het
Olfr458 A G 6: 42,460,974 M15T probably benign Het
Olfr672 A G 7: 104,996,307 L199S possibly damaging Het
Olfr951 A T 9: 39,394,075 I92F probably damaging Het
Olfr98 T A 17: 37,263,641 T8S probably benign Het
Pcnx3 A T 19: 5,672,596 L1356Q probably damaging Het
Pkd1 A T 17: 24,594,536 M4017L probably benign Het
Polg2 A G 11: 106,779,238 C69R possibly damaging Het
Prr5l T G 2: 101,717,107 S358R probably benign Het
Ptprg A G 14: 12,154,111 T611A probably benign Het
Ryk G T 9: 102,897,317 E417* probably null Het
Sbp T C 17: 23,942,422 probably benign Het
Sema4a T C 3: 88,451,497 T155A probably benign Het
Shank3 A G 15: 89,531,711 probably null Het
Slc41a3 A T 6: 90,612,171 N88I possibly damaging Het
Slit3 A G 11: 35,622,148 T534A probably benign Het
Ssx2ip A G 3: 146,436,541 probably null Het
Stard13 T C 5: 151,059,598 K648R probably damaging Het
Tanc1 A T 2: 59,795,834 T512S probably damaging Het
Tbcc T C 17: 46,891,156 V156A probably benign Het
Terf1 T G 1: 15,831,563 I273R possibly damaging Het
Tesc A G 5: 118,059,458 Y179C probably damaging Het
Ttc3 T G 16: 94,384,041 V40G probably damaging Het
Tysnd1 T A 10: 61,696,249 F227I probably damaging Het
Vps53 T C 11: 76,081,208 E271G probably damaging Het
Wdfy4 C T 14: 33,090,866 R1650H probably damaging Het
Other mutations in Slc35d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Slc35d2 APN 13 64098348 missense probably damaging 1.00
IGL02315:Slc35d2 APN 13 64107035 missense possibly damaging 0.87
R1612:Slc35d2 UTSW 13 64111510 splice site probably benign
R2368:Slc35d2 UTSW 13 64129305 start codon destroyed probably null 0.01
R4713:Slc35d2 UTSW 13 64099283 missense possibly damaging 0.94
R5823:Slc35d2 UTSW 13 64120605 missense probably damaging 0.98
R5840:Slc35d2 UTSW 13 64118413 splice site probably null
R8020:Slc35d2 UTSW 13 64107043 missense probably benign 0.05
R9032:Slc35d2 UTSW 13 64108413 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCATTGTGCAGTGACGTG -3'
(R):5'- CTGTCTCCAAACATTTGCAGAG -3'

Sequencing Primer
(F):5'- TTGTGCTCTGACCAAGCAG -3'
(R):5'- CCAAACATTTGCAGAGAAGAAATTTC -3'
Posted On2017-12-01