Incidental Mutation 'R5407:Golga3'
ID 501011
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgi autoantigen, golgin subfamily a, 3
Synonyms repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5407 (G1)
Quality Score 170
Status Not validated
Chromosome 5
Chromosomal Location 110176701-110226470 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 110201990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 656 (Q656*)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000031477
AA Change: Q696*
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: Q696*

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112512
AA Change: Q656*
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: Q656*

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199123
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A C 12: 55,566,196 Y302S probably damaging Het
Arpp21 G T 9: 112,116,753 probably benign Het
Camk1g C T 1: 193,347,372 probably null Het
Cand2 G A 6: 115,785,200 V196I possibly damaging Het
Cdc25b T A 2: 131,193,647 L381Q probably damaging Het
Col17a1 C T 19: 47,666,507 G610E probably damaging Het
Col19a1 C T 1: 24,303,494 E797K probably damaging Het
Col3a1 A T 1: 45,346,052 I110L probably benign Het
Col5a2 T A 1: 45,406,280 D506V possibly damaging Het
Crp A T 1: 172,698,109 probably null Het
Esco1 G T 18: 10,574,886 H729N probably damaging Het
Evx2 A G 2: 74,657,826 S217P probably damaging Het
Gabrb1 T C 5: 72,122,021 V303A possibly damaging Het
Gcnt3 A G 9: 70,034,189 Y366H probably benign Het
Gm436 T C 4: 144,670,325 K279R probably benign Het
Gmpr2 A G 14: 55,678,276 T304A possibly damaging Het
Gramd1b T A 9: 40,455,655 M6L probably damaging Het
Kif17 T C 4: 138,298,221 Y945H probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lrrk1 T A 7: 66,270,797 Q1486L probably benign Het
Mboat7 G T 7: 3,691,381 H72N probably damaging Het
Med12l G A 3: 59,258,201 V1447M probably damaging Het
Mrpl3 T C 9: 105,077,095 F333L probably benign Het
Nav3 T C 10: 109,866,935 T246A probably benign Het
Neil3 A T 8: 53,601,019 V325E probably benign Het
Nlrp4g A T 9: 124,349,930 noncoding transcript Het
Olfr148 A T 9: 39,613,695 I43F probably damaging Het
Onecut1 C T 9: 74,889,456 S419F probably damaging Het
Ptp4a1 A T 1: 30,944,963 V58E probably benign Het
Radil C T 5: 142,508,215 R49H probably damaging Het
Ralgapa1 T C 12: 55,676,797 E1648G possibly damaging Het
Rnft2 C T 5: 118,242,502 M13I probably damaging Het
Satb2 A G 1: 56,948,150 L92P probably damaging Het
Scn4a T C 11: 106,320,889 Y1434C probably damaging Het
Setx T A 2: 29,145,474 M657K probably benign Het
Shd A G 17: 55,973,936 E204G probably damaging Het
Shh T A 5: 28,466,580 R62* probably null Het
Slc9a4 A G 1: 40,607,794 T483A probably benign Het
Tbc1d7 A C 13: 43,154,702 S96A probably benign Het
Tfcp2 T C 15: 100,527,874 probably null Het
Tlk2 T A 11: 105,240,375 S182R probably damaging Het
Tppp2 A G 14: 51,919,498 probably null Het
Trim65 T C 11: 116,126,080 T519A probably benign Het
Trio T C 15: 27,844,806 probably null Het
Usf3 G A 16: 44,217,406 V750I probably benign Het
Utrn T A 10: 12,680,625 K1480N probably damaging Het
Vmn1r58 T A 7: 5,410,873 R119S probably benign Het
Xirp2 A G 2: 67,510,969 I1185V probably benign Het
Zc3h7b A G 15: 81,785,891 H654R probably damaging Het
Zfyve16 G T 13: 92,500,284 A1306E probably damaging Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
cles UTSW 5 110188707 nonsense probably null
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
R8558:Golga3 UTSW 5 110208555 missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110202855 missense probably benign 0.05
R8887:Golga3 UTSW 5 110205760 intron probably benign
R9039:Golga3 UTSW 5 110204933 missense probably benign 0.00
R9045:Golga3 UTSW 5 110193097 missense probably benign 0.00
R9057:Golga3 UTSW 5 110184599 missense probably damaging 1.00
R9100:Golga3 UTSW 5 110189678 missense probably benign 0.31
R9112:Golga3 UTSW 5 110185891 missense probably benign 0.08
R9198:Golga3 UTSW 5 110207753 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTGTTTTCTTATTCAGGCTGACATG -3'
(R):5'- CTGCCTTTCACCCTGGTACAAG -3'

Sequencing Primer
(F):5'- TCAGGCTGACATGTTAGATCAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2017-12-01