Incidental Mutation 'R5410:Hykk'
ID 501017
Institutional Source Beutler Lab
Gene Symbol Hykk
Ensembl Gene ENSMUSG00000035878
Gene Name hydroxylysine kinase 1
Synonyms C630028N24Rik, Agphd1
MMRRC Submission 042979-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 54824574-54857208 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 54853350 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 224 (C224Y)
Ref Sequence ENSEMBL: ENSMUSP00000039980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034848] [ENSMUST00000039742] [ENSMUST00000054018] [ENSMUST00000172407]
AlphaFold Q5U5V2
Predicted Effect probably benign
Transcript: ENSMUST00000034848
SMART Domains Protein: ENSMUSP00000034848
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 216 1.5e-57 PFAM
low complexity region 238 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039742
AA Change: C224Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039980
Gene: ENSMUSG00000035878
AA Change: C224Y

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 36 300 2.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054018
SMART Domains Protein: ENSMUSP00000049861
Gene: ENSMUSG00000044820

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
transmembrane domain 105 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171578
Predicted Effect probably benign
Transcript: ENSMUST00000172407
SMART Domains Protein: ENSMUSP00000126844
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 210 3.2e-56 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 41,134,103 (GRCm39) M524V probably benign Het
Adamts20 T A 15: 94,179,838 (GRCm39) N1788I possibly damaging Het
Arfgef3 T G 10: 18,486,985 (GRCm39) I1350L probably damaging Het
Arhgap17 A G 7: 122,896,716 (GRCm39) probably null Het
Ascl5 A T 1: 135,978,926 (GRCm39) I129F probably damaging Het
AU040320 A T 4: 126,717,509 (GRCm39) H362L possibly damaging Het
Bpifb9a A T 2: 154,112,155 (GRCm39) N564Y probably benign Het
Cdon G T 9: 35,381,331 (GRCm39) D574Y probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Ces1e T A 8: 93,937,070 (GRCm39) I334F possibly damaging Het
Clip2 G A 5: 134,551,645 (GRCm39) T159M possibly damaging Het
Cntn3 T A 6: 102,255,314 (GRCm39) T195S probably benign Het
Csmd2 C A 4: 128,442,612 (GRCm39) H3221Q probably benign Het
Cyp2c68 T C 19: 39,687,728 (GRCm39) D423G possibly damaging Het
Dennd3 C T 15: 73,419,297 (GRCm39) T696M probably benign Het
Ep300 T C 15: 81,533,055 (GRCm39) M1704T unknown Het
Exoc2 A G 13: 31,048,839 (GRCm39) F738S probably damaging Het
Fis1 A G 5: 136,994,420 (GRCm39) E36G probably damaging Het
Galnt1 A G 18: 24,400,604 (GRCm39) I237V probably benign Het
Gspt1 A T 16: 11,048,374 (GRCm39) I416N probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Ifi211 T C 1: 173,733,829 (GRCm39) T111A probably benign Het
Il17rd T C 14: 26,817,868 (GRCm39) Y186H probably damaging Het
Klhl29 G T 12: 5,141,366 (GRCm39) N539K probably benign Het
Lmbr1l T C 15: 98,807,143 (GRCm39) T213A probably damaging Het
Madd C T 2: 90,984,859 (GRCm39) R1318Q probably damaging Het
Mecom C A 3: 30,051,870 (GRCm39) A182S probably benign Het
Or13c25 C A 4: 52,910,991 (GRCm39) A268S probably benign Het
Or1e1 C T 11: 73,244,632 (GRCm39) P18S probably benign Het
Or4f56 C T 2: 111,703,637 (GRCm39) A188T probably damaging Het
Or52z1 A T 7: 103,436,581 (GRCm39) V301E probably damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
Pdia5 A G 16: 35,273,906 (GRCm39) V130A probably damaging Het
Phldb2 T A 16: 45,645,975 (GRCm39) H202L possibly damaging Het
Ppig G A 2: 69,566,241 (GRCm39) G136E probably null Het
Prr14l C A 5: 32,985,121 (GRCm39) R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 (GRCm39) Y714C probably damaging Het
Ptprr T C 10: 116,024,235 (GRCm39) V182A possibly damaging Het
Rai14 A G 15: 10,575,024 (GRCm39) Y645H probably damaging Het
Rasgrp3 T C 17: 75,804,042 (GRCm39) I115T probably benign Het
Rc3h1 G T 1: 160,792,533 (GRCm39) R990L possibly damaging Het
Rdh5 T A 10: 128,754,160 (GRCm39) Q21L probably benign Het
Rfx8 A G 1: 39,749,316 (GRCm39) probably null Het
Scap A G 9: 110,203,250 (GRCm39) probably null Het
Shank1 T A 7: 44,001,246 (GRCm39) S988R unknown Het
Slc16a14 T A 1: 84,885,145 (GRCm39) I465F probably damaging Het
Slc41a2 A G 10: 83,117,232 (GRCm39) probably null Het
Tab2 T C 10: 7,795,585 (GRCm39) H225R possibly damaging Het
Tbx19 T A 1: 164,987,941 (GRCm39) N64I probably damaging Het
Tmprss11f A T 5: 86,677,965 (GRCm39) I268K probably damaging Het
Tox2 A G 2: 163,162,293 (GRCm39) M388V probably benign Het
Trbv17 T C 6: 41,140,472 (GRCm39) L109P probably damaging Het
Trim72 A G 7: 127,609,095 (GRCm39) H299R probably damaging Het
Ulbp3 G A 10: 3,076,473 (GRCm39) noncoding transcript Het
Vmn1r63 C T 7: 5,806,189 (GRCm39) V148I possibly damaging Het
Zfp938 A C 10: 82,061,092 (GRCm39) H509Q possibly damaging Het
Zfyve16 A G 13: 92,657,739 (GRCm39) V724A probably benign Het
Zscan10 T C 17: 23,829,395 (GRCm39) F569L probably damaging Het
Other mutations in Hykk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Hykk APN 9 54,827,842 (GRCm39) missense possibly damaging 0.83
IGL02890:Hykk APN 9 54,827,995 (GRCm39) missense probably benign 0.04
hike UTSW 9 54,853,763 (GRCm39) missense probably benign 0.00
spatziergangen UTSW 9 54,828,010 (GRCm39) missense possibly damaging 0.53
BB001:Hykk UTSW 9 54,829,524 (GRCm39) missense probably damaging 1.00
BB011:Hykk UTSW 9 54,829,524 (GRCm39) missense probably damaging 1.00
R0070:Hykk UTSW 9 54,829,632 (GRCm39) splice site probably benign
R0734:Hykk UTSW 9 54,853,716 (GRCm39) missense possibly damaging 0.93
R0830:Hykk UTSW 9 54,844,601 (GRCm39) missense probably damaging 1.00
R1905:Hykk UTSW 9 54,853,667 (GRCm39) missense probably benign
R2322:Hykk UTSW 9 54,853,418 (GRCm39) missense probably benign 0.00
R4632:Hykk UTSW 9 54,853,800 (GRCm39) missense probably benign 0.01
R4846:Hykk UTSW 9 54,827,890 (GRCm39) missense probably damaging 1.00
R5088:Hykk UTSW 9 54,853,763 (GRCm39) missense probably benign 0.00
R6292:Hykk UTSW 9 54,828,110 (GRCm39) critical splice donor site probably null
R6416:Hykk UTSW 9 54,853,643 (GRCm39) missense probably benign 0.03
R6983:Hykk UTSW 9 54,853,793 (GRCm39) missense probably benign 0.00
R7261:Hykk UTSW 9 54,828,010 (GRCm39) missense possibly damaging 0.53
R7276:Hykk UTSW 9 54,853,502 (GRCm39) missense probably damaging 1.00
R7924:Hykk UTSW 9 54,829,524 (GRCm39) missense probably damaging 1.00
R8539:Hykk UTSW 9 54,844,444 (GRCm39) missense probably benign 0.00
R9646:Hykk UTSW 9 54,853,521 (GRCm39) missense probably benign 0.02
Z1177:Hykk UTSW 9 54,853,713 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCATGCACATAAGACCCTGTG -3'
(R):5'- CACTTTCAAACCCTGCGAGG -3'

Sequencing Primer
(F):5'- GACCCTGTGTCTCCCCC -3'
(R):5'- CTTTCAAACCCTGCGAGGATGTG -3'
Posted On 2017-12-01