Mutagenetix > Incidental Mutation

Incidental Mutation 'R5426:Dsg4'

501025

Institutional Source

Beutler Lab

Gene Symbol

Dsg4

Ensembl Gene

ENSMUSG00000001804

Gene Name

desmoglein 4

Synonyms

lah, CDHF13

MMRRC Submission

042992-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.633) question?

Stock #

R5426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20436175-20471821 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20458484 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 427 (Y427H)

Ref Sequence

ENSEMBL: ENSMUSP00000019426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019426]

AlphaFold

Q7TMD7

Predicted Effect

probably damaging
Transcript: ENSMUST00000019426
AA Change: Y427H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: Y427H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	70	155	1.54e-11	SMART
CA	179	267	4.27e-19	SMART
CA	290	384	5.48e-8	SMART
CA	411	495	9.4e-7	SMART
transmembrane domain	634	656	N/A	INTRINSIC
low complexity region	724	736	N/A	INTRINSIC
Pfam:Cadherin_C	749	849	3.1e-8	PFAM

Meta Mutation Damage Score

0.5800

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (85/88)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,294,003	H122L	probably damaging	Het
9330182O14Rik	G	A	15: 40,148,536	M90I	unknown	Het
9330182O14Rik	G	A	15: 40,148,537	D91N	unknown	Het
Abca13	T	A	11: 9,290,722	S862T	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgb	C	A	10: 10,350,260	A1405S	probably benign	Het
Adpgk	T	A	9: 59,297,549	V86E	probably damaging	Het
Agfg2	G	C	5: 137,667,758	P80A	probably damaging	Het
Akap11	G	A	14: 78,498,864	Q1829*	probably null	Het
Aldh1l1	G	A	6: 90,559,299	R62Q	probably benign	Het
Als2cr12	T	A	1: 58,666,886	K275*	probably null	Het
Amd1	G	T	10: 40,290,187	D265E	probably damaging	Het
Aox4	A	T	1: 58,220,094	Q106L	probably damaging	Het
Arap2	A	T	5: 62,642,816	N1289K	probably benign	Het
Arhgef12	T	C	9: 42,986,584	S874G	probably damaging	Het
BC067074	G	A	13: 113,369,053	V2239I	probably benign	Het
C87499	T	A	4: 88,629,410		probably benign	Het
Ccdc166	T	C	15: 75,982,096	Q45R	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdk14	A	G	5: 4,888,975	S388P	possibly damaging	Het
Chgb	A	T	2: 132,793,533	Q465L	possibly damaging	Het
Commd9	T	A	2: 101,898,875	W109R	probably damaging	Het
Cyp2b9	T	C	7: 26,187,655	V163A	probably benign	Het
Dcpp2	T	A	17: 23,899,313	H27Q	possibly damaging	Het
Ddn	T	A	15: 98,806,466	E315V	possibly damaging	Het
Defb29	C	A	2: 152,538,948	C47F	probably damaging	Het
Dnah7b	T	C	1: 46,242,206	M2809T	possibly damaging	Het
Dock4	A	T	12: 40,745,745	I854F	probably damaging	Het
E130114P18Rik	C	T	4: 97,690,670	A23T	unknown	Het
Gemin5	A	G	11: 58,125,287	S1297P	probably benign	Het
Gm10309	A	C	17: 86,498,733		probably benign	Het
Gm884	A	T	11: 103,620,760	H127Q	unknown	Het
Gpatch11	T	A	17: 78,841,234	S155R	possibly damaging	Het
Grin2b	C	A	6: 135,732,368	Q1393H	probably damaging	Het
Heatr5b	C	T	17: 78,773,713	C1370Y	probably damaging	Het
Hmcn2	C	T	2: 31,336,544	T177I	possibly damaging	Het
Ildr1	A	T	16: 36,709,619	I123F	probably damaging	Het
Kalrn	A	T	16: 34,262,653	V644D	probably damaging	Het
Kifap3	A	G	1: 163,779,871	M1V	probably null	Het
Klhl11	A	G	11: 100,464,116	L293P	probably damaging	Het
Klrc3	G	A	6: 129,641,550	S98L	probably benign	Het
Med12l	G	A	3: 59,248,722	M1220I	probably damaging	Het
Ms4a7	C	T	19: 11,325,802		probably null	Het
Mybpc2	A	G	7: 44,509,829	V599A	probably benign	Het
Naalad2	T	C	9: 18,347,519	N487D	probably benign	Het
Nat8f7	T	G	6: 85,707,823	S12R	probably benign	Het
Nefm	T	A	14: 68,120,066		probably benign	Het
Nlrp5	T	C	7: 23,418,201	V450A	probably damaging	Het
Nps	G	A	7: 135,268,647		probably null	Het
Olfr1247	T	C	2: 89,609,739	Y121C	probably damaging	Het
Olfr142	T	A	2: 90,252,611	K126*	probably null	Het
Olfr159	A	G	4: 43,770,168	I281T	probably benign	Het
Olfr192	G	T	16: 59,098,302	P230Q	possibly damaging	Het
Olfr492	T	C	7: 108,322,810	N289D	probably damaging	Het
Olfr513	T	C	7: 108,755,717	L287P	possibly damaging	Het
Olfr698	C	A	7: 106,752,566	S274I	probably benign	Het
Oxct2a	C	A	4: 123,322,713	G292W	possibly damaging	Het
Prr27	T	C	5: 87,850,885		probably benign	Het
Ptx3	T	C	3: 66,220,722	M68T	probably damaging	Het
Rufy1	A	G	11: 50,421,734	L131S	probably damaging	Het
Sept7	T	A	9: 25,286,690	I100N	possibly damaging	Het
Sgms2	T	C	3: 131,341,797	I143V	probably benign	Het
Slc25a34	A	G	4: 141,623,566	V44A	probably damaging	Het
Slc28a3	T	A	13: 58,563,154	D518V	probably damaging	Het
Slc6a7	C	T	18: 61,003,236		probably null	Het
Slco4a1	C	A	2: 180,471,235	A420D	possibly damaging	Het
Smap1	T	C	1: 23,849,390	T180A	probably benign	Het
Specc1l	T	C	10: 75,267,550	S920P	probably benign	Het
Tgtp2	A	G	11: 49,059,256	M163T	probably benign	Het
Tiam1	G	T	16: 89,865,392	Q613K	possibly damaging	Het
Vsig10l	T	A	7: 43,464,823	S190T	probably damaging	Het
Vwa3b	A	G	1: 37,115,671	Y512C	probably damaging	Het
Wdfy3	T	A	5: 101,919,446	N1207Y	probably damaging	Het
Wdr17	C	T	8: 54,681,399	G349R	probably damaging	Het
Wdr70	A	G	15: 7,922,105	L417S	possibly damaging	Het
Wdr81	A	C	11: 75,450,896	S1182A	possibly damaging	Het
Zfp458	A	T	13: 67,257,192	C391*	probably null	Het
Zfp638	A	G	6: 83,976,414	E1167G	probably damaging	Het
Zfp763	T	A	17: 33,019,595	D192V	probably benign	Het
Zfp853	T	G	5: 143,288,869	Q332P	unknown	Het

Other mutations in Dsg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Dsg4	APN	18	20461326	missense	probably benign	0.22
IGL01723:Dsg4	APN	18	20466510	missense	probably damaging	1.00
IGL02249:Dsg4	APN	18	20461304	missense	possibly damaging	0.69
IGL02445:Dsg4	APN	18	20446250	splice site	probably benign
IGL02553:Dsg4	APN	18	20462520	missense	probably benign
IGL02578:Dsg4	APN	18	20471193	missense	possibly damaging	0.94
IGL02634:Dsg4	APN	18	20458580	missense	probably benign	0.01
IGL02677:Dsg4	APN	18	20464876	missense	possibly damaging	0.62
IGL02741:Dsg4	APN	18	20471496	missense	probably benign
IGL02747:Dsg4	APN	18	20446938	missense	probably damaging	0.97
IGL03342:Dsg4	APN	18	20451823	missense	probably damaging	1.00
burrito	UTSW	18	20451862	missense	possibly damaging	0.81
woodshed	UTSW	18	20451872	nonsense	probably null
R0043:Dsg4	UTSW	18	20452972	missense	probably damaging	1.00
R0375:Dsg4	UTSW	18	20470879	missense	probably damaging	1.00
R0537:Dsg4	UTSW	18	20458571	missense	probably damaging	1.00
R0619:Dsg4	UTSW	18	20461359	missense	probably benign	0.00
R0622:Dsg4	UTSW	18	20449788	missense	possibly damaging	0.51
R0765:Dsg4	UTSW	18	20454646	splice site	probably benign
R0786:Dsg4	UTSW	18	20449372	critical splice donor site	probably null
R1114:Dsg4	UTSW	18	20466483	missense	possibly damaging	0.62
R1249:Dsg4	UTSW	18	20446872	nonsense	probably null
R1372:Dsg4	UTSW	18	20449676	splice site	probably null
R1382:Dsg4	UTSW	18	20465124	missense	probably benign	0.00
R1392:Dsg4	UTSW	18	20446247	splice site	probably benign
R1442:Dsg4	UTSW	18	20462660	missense	possibly damaging	0.76
R1503:Dsg4	UTSW	18	20449679	missense	probably damaging	1.00
R1704:Dsg4	UTSW	18	20471589	missense	probably damaging	1.00
R1716:Dsg4	UTSW	18	20462461	nonsense	probably null
R1765:Dsg4	UTSW	18	20456831	missense	probably benign	0.01
R1817:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R1982:Dsg4	UTSW	18	20471212	missense	probably damaging	1.00
R2025:Dsg4	UTSW	18	20466636	nonsense	probably null
R2097:Dsg4	UTSW	18	20471044	missense	probably damaging	1.00
R2198:Dsg4	UTSW	18	20461442	missense	probably benign
R3551:Dsg4	UTSW	18	20451756	missense	probably damaging	1.00
R3742:Dsg4	UTSW	18	20471001	missense	probably damaging	1.00
R3853:Dsg4	UTSW	18	20449234	missense	probably benign
R3955:Dsg4	UTSW	18	20449375	splice site	probably null
R4006:Dsg4	UTSW	18	20470965	missense	probably damaging	0.97
R4012:Dsg4	UTSW	18	20451862	missense	possibly damaging	0.81
R4171:Dsg4	UTSW	18	20458579	nonsense	probably null
R4254:Dsg4	UTSW	18	20471538	missense	probably benign	0.07
R4504:Dsg4	UTSW	18	20461436	missense	probably benign	0.00
R4559:Dsg4	UTSW	18	20470921	missense	probably damaging	1.00
R4607:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R4612:Dsg4	UTSW	18	20462413	missense	probably benign	0.10
R4683:Dsg4	UTSW	18	20461409	missense	probably benign
R4700:Dsg4	UTSW	18	20456908	missense	possibly damaging	0.91
R4749:Dsg4	UTSW	18	20446831	missense	possibly damaging	0.88
R4775:Dsg4	UTSW	18	20471127	missense	possibly damaging	0.48
R4809:Dsg4	UTSW	18	20466621	missense	possibly damaging	0.82
R5276:Dsg4	UTSW	18	20446839	missense	probably benign	0.21
R5767:Dsg4	UTSW	18	20462492	nonsense	probably null
R5982:Dsg4	UTSW	18	20465169	missense	possibly damaging	0.76
R6280:Dsg4	UTSW	18	20466667	missense	probably damaging	1.00
R6305:Dsg4	UTSW	18	20449790	missense	probably damaging	1.00
R6489:Dsg4	UTSW	18	20471363	missense	possibly damaging	0.93
R7013:Dsg4	UTSW	18	20458521	missense	possibly damaging	0.58
R7040:Dsg4	UTSW	18	20451852	missense	probably benign	0.01
R7196:Dsg4	UTSW	18	20466480	missense	probably damaging	1.00
R7432:Dsg4	UTSW	18	20446266	nonsense	probably null
R7438:Dsg4	UTSW	18	20466628	missense	probably damaging	0.96
R7490:Dsg4	UTSW	18	20451936	splice site	probably null
R7612:Dsg4	UTSW	18	20470990	missense	probably damaging	1.00
R7639:Dsg4	UTSW	18	20449712	missense	probably damaging	1.00
R7905:Dsg4	UTSW	18	20454669	missense	probably damaging	1.00
R8251:Dsg4	UTSW	18	20471164	missense	probably damaging	1.00
R8326:Dsg4	UTSW	18	20449731	missense	probably benign	0.31
R8554:Dsg4	UTSW	18	20453043	missense	probably damaging	1.00
R8911:Dsg4	UTSW	18	20451872	nonsense	probably null
R9059:Dsg4	UTSW	18	20471125	missense	possibly damaging	0.62
R9508:Dsg4	UTSW	18	20471013	missense	probably damaging	1.00
R9607:Dsg4	UTSW	18	20452990	missense	probably benign	0.00
R9765:Dsg4	UTSW	18	20471277	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTTAATCCTGGATACTCACCGG -3'
(R):5'- GTGAGATACATTTTGGCTTGAGTAC -3'

Sequencing Primer
(F):5'- TGGATACTCACCGGGACAC -3'
(R):5'- CATTTTGGCTTGAGTACAATTTATGG -3'

Posted On

2017-12-01