Incidental Mutation 'R5426:Dsg4'
ID501025
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission 042992-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R5426 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20458484 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 427 (Y427H)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: Y427H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: Y427H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Meta Mutation Damage Score 0.5800 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,003 H122L probably damaging Het
9330182O14Rik G A 15: 40,148,536 M90I unknown Het
9330182O14Rik G A 15: 40,148,537 D91N unknown Het
Abca13 T A 11: 9,290,722 S862T probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgb C A 10: 10,350,260 A1405S probably benign Het
Adpgk T A 9: 59,297,549 V86E probably damaging Het
Agfg2 G C 5: 137,667,758 P80A probably damaging Het
Akap11 G A 14: 78,498,864 Q1829* probably null Het
Aldh1l1 G A 6: 90,559,299 R62Q probably benign Het
Als2cr12 T A 1: 58,666,886 K275* probably null Het
Amd1 G T 10: 40,290,187 D265E probably damaging Het
Aox4 A T 1: 58,220,094 Q106L probably damaging Het
Arap2 A T 5: 62,642,816 N1289K probably benign Het
Arhgef12 T C 9: 42,986,584 S874G probably damaging Het
BC067074 G A 13: 113,369,053 V2239I probably benign Het
C87499 T A 4: 88,629,410 probably benign Het
Ccdc166 T C 15: 75,982,096 Q45R possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk14 A G 5: 4,888,975 S388P possibly damaging Het
Chgb A T 2: 132,793,533 Q465L possibly damaging Het
Commd9 T A 2: 101,898,875 W109R probably damaging Het
Cyp2b9 T C 7: 26,187,655 V163A probably benign Het
Dcpp2 T A 17: 23,899,313 H27Q possibly damaging Het
Ddn T A 15: 98,806,466 E315V possibly damaging Het
Defb29 C A 2: 152,538,948 C47F probably damaging Het
Dnah7b T C 1: 46,242,206 M2809T possibly damaging Het
Dock4 A T 12: 40,745,745 I854F probably damaging Het
E130114P18Rik C T 4: 97,690,670 A23T unknown Het
Gemin5 A G 11: 58,125,287 S1297P probably benign Het
Gm10309 A C 17: 86,498,733 probably benign Het
Gm884 A T 11: 103,620,760 H127Q unknown Het
Gpatch11 T A 17: 78,841,234 S155R possibly damaging Het
Grin2b C A 6: 135,732,368 Q1393H probably damaging Het
Heatr5b C T 17: 78,773,713 C1370Y probably damaging Het
Hmcn2 C T 2: 31,336,544 T177I possibly damaging Het
Ildr1 A T 16: 36,709,619 I123F probably damaging Het
Kalrn A T 16: 34,262,653 V644D probably damaging Het
Kifap3 A G 1: 163,779,871 M1V probably null Het
Klhl11 A G 11: 100,464,116 L293P probably damaging Het
Klrc3 G A 6: 129,641,550 S98L probably benign Het
Med12l G A 3: 59,248,722 M1220I probably damaging Het
Ms4a7 C T 19: 11,325,802 probably null Het
Mybpc2 A G 7: 44,509,829 V599A probably benign Het
Naalad2 T C 9: 18,347,519 N487D probably benign Het
Nat8f7 T G 6: 85,707,823 S12R probably benign Het
Nefm T A 14: 68,120,066 probably benign Het
Nlrp5 T C 7: 23,418,201 V450A probably damaging Het
Nps G A 7: 135,268,647 probably null Het
Olfr1247 T C 2: 89,609,739 Y121C probably damaging Het
Olfr142 T A 2: 90,252,611 K126* probably null Het
Olfr159 A G 4: 43,770,168 I281T probably benign Het
Olfr192 G T 16: 59,098,302 P230Q possibly damaging Het
Olfr492 T C 7: 108,322,810 N289D probably damaging Het
Olfr513 T C 7: 108,755,717 L287P possibly damaging Het
Olfr698 C A 7: 106,752,566 S274I probably benign Het
Oxct2a C A 4: 123,322,713 G292W possibly damaging Het
Prr27 T C 5: 87,850,885 probably benign Het
Ptx3 T C 3: 66,220,722 M68T probably damaging Het
Rufy1 A G 11: 50,421,734 L131S probably damaging Het
Sept7 T A 9: 25,286,690 I100N possibly damaging Het
Sgms2 T C 3: 131,341,797 I143V probably benign Het
Slc25a34 A G 4: 141,623,566 V44A probably damaging Het
Slc28a3 T A 13: 58,563,154 D518V probably damaging Het
Slc6a7 C T 18: 61,003,236 probably null Het
Slco4a1 C A 2: 180,471,235 A420D possibly damaging Het
Smap1 T C 1: 23,849,390 T180A probably benign Het
Specc1l T C 10: 75,267,550 S920P probably benign Het
Tgtp2 A G 11: 49,059,256 M163T probably benign Het
Tiam1 G T 16: 89,865,392 Q613K possibly damaging Het
Vsig10l T A 7: 43,464,823 S190T probably damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Wdfy3 T A 5: 101,919,446 N1207Y probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wdr70 A G 15: 7,922,105 L417S possibly damaging Het
Wdr81 A C 11: 75,450,896 S1182A possibly damaging Het
Zfp458 A T 13: 67,257,192 C391* probably null Het
Zfp638 A G 6: 83,976,414 E1167G probably damaging Het
Zfp763 T A 17: 33,019,595 D192V probably benign Het
Zfp853 T G 5: 143,288,869 Q332P unknown Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 intron probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R7988:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAATCCTGGATACTCACCGG -3'
(R):5'- GTGAGATACATTTTGGCTTGAGTAC -3'

Sequencing Primer
(F):5'- TGGATACTCACCGGGACAC -3'
(R):5'- CATTTTGGCTTGAGTACAATTTATGG -3'
Posted On2017-12-01