Incidental Mutation 'R5442:Oas1a'
ID501026
Institutional Source Beutler Lab
Gene Symbol Oas1a
Ensembl Gene ENSMUSG00000052776
Gene Name2'-5' oligoadenylate synthetase 1A
SynonymsL3
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120896256-120907521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120897206 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 349 (T349A)
Ref Sequence ENSEMBL: ENSMUSP00000079198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080322]
Predicted Effect probably benign
Transcript: ENSMUST00000080322
AA Change: T349A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000079198
Gene: ENSMUSG00000052776
AA Change: T349A

DomainStartEndE-ValueType
Pfam:NTP_transf_2 38 139 9.8e-14 PFAM
Pfam:OAS1_C 164 349 1.9e-87 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Oas1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01822:Oas1a APN 5 120899214 missense probably benign 0.01
IGL02299:Oas1a APN 5 120905692 missense probably benign
IGL02951:Oas1a APN 5 120905664 missense probably damaging 1.00
IGL03112:Oas1a APN 5 120898349 missense possibly damaging 0.95
IGL03230:Oas1a APN 5 120898356 missense probably benign 0.23
IGL03356:Oas1a APN 5 120905845 missense probably damaging 0.99
IGL03379:Oas1a APN 5 120896999 missense possibly damaging 0.70
R0625:Oas1a UTSW 5 120899259 missense probably damaging 1.00
R1279:Oas1a UTSW 5 120897178 critical splice donor site probably null
R1914:Oas1a UTSW 5 120905813 missense possibly damaging 0.48
R1915:Oas1a UTSW 5 120905813 missense possibly damaging 0.48
R4758:Oas1a UTSW 5 120907338 missense probably damaging 1.00
R4928:Oas1a UTSW 5 120905724 missense probably benign
R5267:Oas1a UTSW 5 120899221 missense probably benign 0.00
R5487:Oas1a UTSW 5 120907427 missense probably damaging 1.00
R6853:Oas1a UTSW 5 120907428 missense possibly damaging 0.95
R6880:Oas1a UTSW 5 120901940 missense probably damaging 0.97
R7953:Oas1a UTSW 5 120897017 missense probably benign 0.32
R8043:Oas1a UTSW 5 120897017 missense probably benign 0.32
R8363:Oas1a UTSW 5 120905839 missense probably damaging 1.00
R8738:Oas1a UTSW 5 120901956 missense probably damaging 1.00
Z1177:Oas1a UTSW 5 120901895 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCTTCTACCTGAGGATGGAGGG -3'
(R):5'- CAGATCTACTAATGAAGAAGGGCC -3'

Sequencing Primer
(F):5'- GAAGGTAGAGCATGGTCAAAACATC -3'
(R):5'- GGGGGTCTTATGTACCCTTAATGGC -3'
Posted On2017-12-01