Incidental Mutation 'R5411:Wdfy4'
ID501030
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene NameWD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission 042980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5411 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32959547-33185508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32960002 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 3004 (N3004S)
Ref Sequence ENSEMBL: ENSMUSP00000057556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
Predicted Effect probably damaging
Transcript: ENSMUST00000061753
AA Change: N3004S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: N3004S

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130509
AA Change: N3163S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: N3163S

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C A 9: 53,582,646 V392F probably damaging Het
Ache C T 5: 137,290,064 P11S possibly damaging Het
Ache T A 5: 137,290,430 probably null Het
Acoxl A T 2: 127,854,901 H23L probably benign Het
Adamtsl1 G A 4: 86,388,413 probably null Het
Adar T A 3: 89,739,212 F45I probably benign Het
Adgrf4 A C 17: 42,667,213 L413R probably damaging Het
Atp6v1g3 A T 1: 138,287,889 I96F probably benign Het
Brsk2 T C 7: 142,000,857 M653T probably benign Het
Cacna1s G T 1: 136,105,811 V1275L probably benign Het
Ces3b T C 8: 105,088,632 V5A possibly damaging Het
Chpt1 A T 10: 88,477,107 I281N probably damaging Het
Col10a1 A G 10: 34,394,557 E175G probably damaging Het
Col27a1 T C 4: 63,224,665 S197P probably damaging Het
Csmd1 T A 8: 15,910,471 R3315W probably damaging Het
Ctnna2 T C 6: 77,114,931 E443G probably damaging Het
Dhx9 G T 1: 153,481,223 S93R probably benign Het
Efcab8 A G 2: 153,783,756 H112R probably damaging Het
Eif3d A T 15: 77,959,687 N486K probably damaging Het
Esp8 C T 17: 40,530,018 R57* probably null Het
Eya3 A T 4: 132,689,779 I130F probably damaging Het
Fat2 G T 11: 55,252,226 L4266I probably benign Het
Fras1 T A 5: 96,645,160 D983E probably benign Het
Gcc2 T C 10: 58,270,969 S640P probably damaging Het
Gm13119 T A 4: 144,361,637 M1K probably null Het
Gys2 C T 6: 142,448,421 G464R probably damaging Het
Heatr5a G A 12: 51,888,243 T1659I probably damaging Het
Il17ra A G 6: 120,481,442 D518G probably damaging Het
Kcnk13 A G 12: 100,061,251 Y195C probably damaging Het
Kmt2a T A 9: 44,848,485 H722L probably damaging Het
Luzp1 C A 4: 136,543,342 Q959K possibly damaging Het
Mep1b T A 18: 21,086,249 H153Q probably damaging Het
Mfsd13b A T 7: 121,000,123 I381F probably benign Het
Mvk A G 5: 114,458,973 T334A probably benign Het
Naa30 T C 14: 49,187,551 V320A probably damaging Het
Naip5 C T 13: 100,245,746 G152S possibly damaging Het
Neb A C 2: 52,295,372 S949R probably damaging Het
Nfya A T 17: 48,392,018 I214N possibly damaging Het
Nsf G T 11: 103,882,811 N292K probably damaging Het
Nup133 T C 8: 123,927,206 T505A probably benign Het
Olfr1178 A G 2: 88,391,261 T5A probably benign Het
Olfr1231 A C 2: 89,303,576 S5R probably benign Het
Olfr1413 A T 1: 92,573,824 T218S probably benign Het
Olfr192 T A 16: 59,098,704 H96L unknown Het
P4ha3 A T 7: 100,293,815 R136W probably damaging Het
Parp12 A G 6: 39,090,208 V550A probably damaging Het
Phf11a T C 14: 59,294,938 D16G probably benign Het
Rab3gap2 A G 1: 185,277,145 probably null Het
Sco1 A G 11: 67,063,958 D263G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sfpq T A 4: 127,021,723 S103T unknown Het
Shisa7 G A 7: 4,829,976 R263C probably damaging Het
Ssc4d T A 5: 135,963,400 D144V probably benign Het
Stxbp5l G A 16: 37,129,851 P1044L probably damaging Het
Tgm6 G A 2: 130,145,196 R528Q probably benign Het
Tlr3 A T 8: 45,396,955 H892Q probably benign Het
Tmc2 A G 2: 130,240,115 H406R probably damaging Het
Tmtc1 A T 6: 148,443,899 probably null Het
Ttc19 A G 11: 62,284,151 I139M probably benign Het
Utrn G A 10: 12,649,185 R2185C probably benign Het
Wdr3 C A 3: 100,142,984 G746W probably damaging Het
Zfp335 T A 2: 164,902,245 Q500L probably damaging Het
Zfp804b A T 5: 6,770,071 D961E probably benign Het
Zkscan16 CTTCAGCTTTCA CTTCA 4: 58,956,745 probably null Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 33102539 missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32959977 missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 33104037 missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 33151661 missense probably benign 0.01
IGL01700:Wdfy4 APN 14 33020238 splice site probably benign
IGL01931:Wdfy4 APN 14 33155753 missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 33133716 missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 33076480 missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 33093300 missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 33149566 missense probably benign
IGL02468:Wdfy4 APN 14 32966432 missense probably benign 0.01
IGL02512:Wdfy4 APN 14 33042491 missense probably benign 0.01
IGL02597:Wdfy4 APN 14 33090861 nonsense probably null
IGL02752:Wdfy4 APN 14 33076326 missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 33095305 missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32971750 missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 33109650 missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 33076284 missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 33140651 missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32966435 missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 33162870 missense probably benign 0.01
IGL03198:Wdfy4 APN 14 33125887 missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32977167 missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 33068904 missense probably benign 0.01
IGL03398:Wdfy4 APN 14 33047290 missense probably benign 0.14
dodgers UTSW 14 32977106 nonsense probably null
Dollar UTSW 14 33020311 missense probably damaging 1.00
Giants UTSW 14 33070618 nonsense probably null
gigantea UTSW 14 32974154 critical splice donor site probably null
kings_canyon UTSW 14 33109519 nonsense probably null
moro UTSW 14 32964626 splice site probably null
sequoia UTSW 14 33100903 critical splice donor site probably null
Sherman UTSW 14 33095951 missense possibly damaging 0.89
watchtower UTSW 14 33083639 critical splice donor site probably null
R0014:Wdfy4 UTSW 14 33107173 missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 33162751 missense probably null 1.00
R0085:Wdfy4 UTSW 14 33078243 missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 33083785 missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 33083812 splice site probably benign
R0496:Wdfy4 UTSW 14 33140738 splice site probably benign
R0514:Wdfy4 UTSW 14 33080775 missense probably benign 0.22
R0548:Wdfy4 UTSW 14 33042621 missense probably benign
R0590:Wdfy4 UTSW 14 33041174 missense probably benign 0.09
R0647:Wdfy4 UTSW 14 33109699 missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 33140612 missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 33147092 missense probably benign 0.03
R1024:Wdfy4 UTSW 14 33079966 missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32971738 missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32971772 splice site probably null
R1415:Wdfy4 UTSW 14 33041180 missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 33108688 missense probably benign 0.14
R1483:Wdfy4 UTSW 14 33100966 missense probably benign 0.41
R1490:Wdfy4 UTSW 14 33152538 critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32960808 missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32959961 missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 33073585 critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 33096005 missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 33103983 missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 33133344 missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32971684 missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 33106044 missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 33146989 missense probably benign 0.11
R2241:Wdfy4 UTSW 14 33073511 missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 33162807 missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 33109519 nonsense probably null
R2889:Wdfy4 UTSW 14 33109519 nonsense probably null
R3114:Wdfy4 UTSW 14 33089903 missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3758:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3797:Wdfy4 UTSW 14 33140645 missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32966395 missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 33102680 splice site probably benign
R4091:Wdfy4 UTSW 14 33125880 missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 33096083 missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 33087955 missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32989936 missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 33109548 missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 33145316 missense probably benign 0.03
R4862:Wdfy4 UTSW 14 33100903 critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32988895 nonsense probably null
R4894:Wdfy4 UTSW 14 33155760 missense probably benign 0.03
R4929:Wdfy4 UTSW 14 33047256 missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 33029013 missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 33100940 missense probably benign 0.02
R5020:Wdfy4 UTSW 14 33079935 missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 33152670 missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 33047275 missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 33078343 missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 33090866 missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32988899 missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 33020311 missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 33151732 missense probably benign 0.17
R5591:Wdfy4 UTSW 14 33107130 missense probably benign 0.09
R5598:Wdfy4 UTSW 14 33133497 missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 33107618 splice site probably null
R5890:Wdfy4 UTSW 14 33102577 missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 33133360 missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 33106011 missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 33083639 critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32971711 missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 33109525 missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 33101049 nonsense probably null
R6370:Wdfy4 UTSW 14 33068850 missense probably benign 0.16
R6390:Wdfy4 UTSW 14 33104094 missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32967647 missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 33108692 missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 33146944 missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 33047251 missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 33095951 missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32959966 missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 33099117 missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32964626 splice site probably null
R7101:Wdfy4 UTSW 14 32960820 missense
R7114:Wdfy4 UTSW 14 32971574 splice site probably null
R7139:Wdfy4 UTSW 14 33151578 missense
R7255:Wdfy4 UTSW 14 32974282 missense
R7324:Wdfy4 UTSW 14 33047314 missense
R7379:Wdfy4 UTSW 14 33151609 missense
R7399:Wdfy4 UTSW 14 33068906 missense
R7408:Wdfy4 UTSW 14 33078307 missense
R7410:Wdfy4 UTSW 14 32974234 missense
R7411:Wdfy4 UTSW 14 33106131 missense
R7412:Wdfy4 UTSW 14 33149584 missense
R7445:Wdfy4 UTSW 14 33070618 nonsense probably null
R7595:Wdfy4 UTSW 14 32974154 critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32985739 missense
R7622:Wdfy4 UTSW 14 33078274 missense
R7828:Wdfy4 UTSW 14 32988921 missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 33090963 missense
R7946:Wdfy4 UTSW 14 33070748 missense
R7946:Wdfy4 UTSW 14 33104115 missense
R7986:Wdfy4 UTSW 14 33104115 missense
R7990:Wdfy4 UTSW 14 33097795 missense
R8001:Wdfy4 UTSW 14 32973535 critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32971627 missense
R8015:Wdfy4 UTSW 14 33107747 missense
R8032:Wdfy4 UTSW 14 33029086 nonsense probably null
R8041:Wdfy4 UTSW 14 33154008 critical splice donor site probably null
R8090:Wdfy4 UTSW 14 33104115 missense
R8092:Wdfy4 UTSW 14 33104115 missense
R8112:Wdfy4 UTSW 14 33104115 missense
R8114:Wdfy4 UTSW 14 33104115 missense
R8115:Wdfy4 UTSW 14 33104115 missense
R8117:Wdfy4 UTSW 14 32977106 nonsense probably null
R8117:Wdfy4 UTSW 14 33104115 missense
R8118:Wdfy4 UTSW 14 33104115 missense
R8140:Wdfy4 UTSW 14 33142360 missense
R8155:Wdfy4 UTSW 14 33162819 missense
R8163:Wdfy4 UTSW 14 33151588 missense
R8293:Wdfy4 UTSW 14 32974261 missense
R8325:Wdfy4 UTSW 14 32967487 missense
R8370:Wdfy4 UTSW 14 33093251 missense
R8437:Wdfy4 UTSW 14 33076375 missense
X0028:Wdfy4 UTSW 14 33080636 missense probably benign
X0053:Wdfy4 UTSW 14 33162942 start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 33107618 splice site probably null
Z1177:Wdfy4 UTSW 14 33087985 missense
Predicted Primers PCR Primer
(F):5'- TTGCTCTGGTTAAGCAGCCC -3'
(R):5'- CTGGTGTAGGAAGTGCACAGTG -3'

Sequencing Primer
(F):5'- GCCCAGGCTACACATCATCTTG -3'
(R):5'- GCACAGTGTTCTGGATGCC -3'
Posted On2017-12-01