Incidental Mutation 'R5413:Adamts3'
ID501033
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms6330442E02Rik, 1100001H14Rik
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location89677087-89883334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89708767 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 316 (S316P)
Ref Sequence ENSEMBL: ENSMUSP00000058552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
Predicted Effect probably damaging
Transcript: ENSMUST00000061427
AA Change: S316P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: S316P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163159
AA Change: S316P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: S316P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0477:Adamts3 UTSW 5 89684507 missense probably benign
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89775421 missense probably benign 0.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89677816 missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5097:Adamts3 UTSW 5 89693050 missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
R7172:Adamts3 UTSW 5 89883001 start gained probably benign
R7263:Adamts3 UTSW 5 89677742 missense probably benign 0.03
R7401:Adamts3 UTSW 5 89707450 critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 89861397 missense probably benign 0.00
R7829:Adamts3 UTSW 5 89861490 missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89700440 missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 89861429 missense probably benign 0.10
R8021:Adamts3 UTSW 5 89683184 missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89775423 missense possibly damaging 0.89
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89775351 missense not run
Z1177:Adamts3 UTSW 5 89707864 nonsense probably null
Z1177:Adamts3 UTSW 5 89775351 missense not run
Predicted Primers PCR Primer
(F):5'- TTGGGGTTTCGCTTGAAAAC -3'
(R):5'- ATGCCTGTTTCTGTGGACATTC -3'

Sequencing Primer
(F):5'- GTTTCGCTTGAAAACCCAGG -3'
(R):5'- GACCTCACAAGGAAGTCTT -3'
Posted On2017-12-01