Incidental Mutation 'R5413:Prmt9'
ID501034
Institutional Source Beutler Lab
Gene Symbol Prmt9
Ensembl Gene ENSMUSG00000037134
Gene Nameprotein arginine methyltransferase 9
SynonymsPrmt10
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location77549397-77581338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77572009 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 444 (D444V)
Ref Sequence ENSEMBL: ENSMUSP00000112692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056237] [ENSMUST00000118622] [ENSMUST00000210040]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056237
AA Change: D444V

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050181
Gene: ENSMUSG00000037134
AA Change: D444V

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:TPR_11 67 132 1.2e-7 PFAM
Pfam:TPR_2 102 134 7.9e-5 PFAM
Pfam:PrmA 168 257 2.5e-10 PFAM
internal_repeat_1 585 836 1.37e-10 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000118622
AA Change: D444V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112692
Gene: ENSMUSG00000037134
AA Change: D444V

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:TPR_2 102 134 3e-5 PFAM
Pfam:PrmA 168 257 4.9e-10 PFAM
internal_repeat_1 585 836 1.05e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209267
Predicted Effect probably benign
Transcript: ENSMUST00000210040
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Prmt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01801:Prmt9 APN 8 77562440 missense probably damaging 1.00
IGL02306:Prmt9 APN 8 77560818 missense probably benign 0.06
IGL02971:Prmt9 APN 8 77565069 missense probably benign 0.00
1mM(1):Prmt9 UTSW 8 77555764 missense probably benign 0.01
R0004:Prmt9 UTSW 8 77555782 missense possibly damaging 0.81
R0928:Prmt9 UTSW 8 77581176 missense probably damaging 1.00
R1328:Prmt9 UTSW 8 77572654 missense possibly damaging 0.86
R1777:Prmt9 UTSW 8 77565108 missense probably benign 0.05
R1826:Prmt9 UTSW 8 77555674 nonsense probably null
R1925:Prmt9 UTSW 8 77577339 missense possibly damaging 0.52
R3855:Prmt9 UTSW 8 77568265 missense probably benign 0.22
R3856:Prmt9 UTSW 8 77568265 missense probably benign 0.22
R4089:Prmt9 UTSW 8 77572545 missense probably benign 0.00
R4963:Prmt9 UTSW 8 77555729 missense probably damaging 1.00
R5196:Prmt9 UTSW 8 77564997 missense probably benign 0.30
R5975:Prmt9 UTSW 8 77561018 intron probably benign
R6271:Prmt9 UTSW 8 77577463 missense probably damaging 0.96
R7023:Prmt9 UTSW 8 77549457 start gained probably benign
R7107:Prmt9 UTSW 8 77568251 missense possibly damaging 0.62
R7159:Prmt9 UTSW 8 77555764 missense probably benign 0.01
R7209:Prmt9 UTSW 8 77564998 missense probably benign 0.32
R7770:Prmt9 UTSW 8 77559185 splice site probably null
R7819:Prmt9 UTSW 8 77568344 missense probably benign 0.11
R7959:Prmt9 UTSW 8 77560965 missense probably damaging 1.00
X0027:Prmt9 UTSW 8 77560883 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GATGGGCCAGATAAACTCTTTCC -3'
(R):5'- CACTACAGAGTTCAGCTTCATTTCC -3'

Sequencing Primer
(F):5'- GGGCCAGATAAACTCTTTCCTTTCC -3'
(R):5'- CAGAGTTCAGCTTCATTTCCTAGAG -3'
Posted On2017-12-01