Incidental Mutation 'R5419:Eif2d'
ID501043
Institutional Source Beutler Lab
Gene Symbol Eif2d
Ensembl Gene ENSMUSG00000026427
Gene Nameeukaryotic translation initiation factor 2D
SynonymsLgtn, D1Ertd5e
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5419 (G1)
Quality Score160
Status Not validated
Chromosome1
Chromosomal Location131153181-131187658 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 131158298 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 177 (*177R)
Ref Sequence ENSEMBL: ENSMUSP00000137887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068791] [ENSMUST00000068805] [ENSMUST00000112446] [ENSMUST00000131855] [ENSMUST00000149119] [ENSMUST00000151874]
Predicted Effect probably damaging
Transcript: ENSMUST00000068791
AA Change: W177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067461
Gene: ENSMUSG00000026427
AA Change: W177R

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068805
AA Change: W177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063894
Gene: ENSMUSG00000026427
AA Change: W177R

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 474 554 1.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112446
AA Change: W177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108065
Gene: ENSMUSG00000026427
AA Change: W177R

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 472 551 3.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131855
AA Change: W177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137678
Gene: ENSMUSG00000026427
AA Change: W177R

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 472 554 8.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139468
Predicted Effect probably null
Transcript: ENSMUST00000149119
AA Change: *177R
SMART Domains Protein: ENSMUSP00000137887
Gene: ENSMUSG00000026427
AA Change: *177R

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151874
AA Change: W177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138061
Gene: ENSMUSG00000026427
AA Change: W177R

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 472 556 1e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a translation initiation factor involved in the recruitment and delivery of aminoacyl-tRNAs to the P-site of the eukaryotic ribosome in a GTP-independent manner. This gene was previously referred to as ligatin, but is now known to localize to the cytoplasm and localize and function with translation factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Eif2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Eif2d APN 1 131166352 missense probably benign 0.06
IGL00848:Eif2d APN 1 131164436 nonsense probably null
IGL02250:Eif2d APN 1 131160429 missense probably benign 0.34
IGL02423:Eif2d APN 1 131153360 utr 5 prime probably benign
IGL02877:Eif2d APN 1 131165117 splice site probably benign
R0001:Eif2d UTSW 1 131168127 nonsense probably null
R0593:Eif2d UTSW 1 131155728 splice site probably benign
R0739:Eif2d UTSW 1 131154363 missense probably damaging 1.00
R1842:Eif2d UTSW 1 131171060 missense probably damaging 1.00
R2088:Eif2d UTSW 1 131164727 missense probably damaging 0.98
R4206:Eif2d UTSW 1 131154363 missense probably damaging 1.00
R4732:Eif2d UTSW 1 131164727 missense probably damaging 0.98
R4733:Eif2d UTSW 1 131164727 missense probably damaging 0.98
R4734:Eif2d UTSW 1 131165152 missense probably damaging 1.00
R4931:Eif2d UTSW 1 131154391 missense probably damaging 1.00
R5281:Eif2d UTSW 1 131173343 missense probably damaging 1.00
R5773:Eif2d UTSW 1 131158303 splice site probably null
R6074:Eif2d UTSW 1 131166342 missense probably damaging 1.00
R6947:Eif2d UTSW 1 131164667 missense probably benign 0.00
R7396:Eif2d UTSW 1 131166374 missense probably benign 0.13
R7419:Eif2d UTSW 1 131171056 missense probably benign 0.00
R7630:Eif2d UTSW 1 131154366 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCTTGCTATGAGGGAAACTG -3'
(R):5'- GCCTCTAGATTCTTGTCTGGAC -3'

Sequencing Primer
(F):5'- TCTGAACTGAACGGGTCCC -3'
(R):5'- TGGACAAATAAAACTGTATTTCCCCC -3'
Posted On2017-12-01