Incidental Mutation 'R0130:Atp8b5'
ID 50105
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene Name ATPase, class I, type 8B, member 5
Synonyms 4930417M19Rik, FetA
MMRRC Submission 038415-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R0130 (G1)
Quality Score 222
Status Validated (trace)
Chromosome 4
Chromosomal Location 43267159-43373833 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 43369715 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107937] [ENSMUST00000107942]
AlphaFold A3FIN4
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect probably null
Transcript: ENSMUST00000107942
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,994,094 (GRCm39) Y37F probably damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Apol7c A G 15: 77,410,562 (GRCm39) I128T possibly damaging Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Arfip2 A G 7: 105,288,205 (GRCm39) probably benign Het
Atp5mf A T 5: 145,124,992 (GRCm39) probably benign Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Cd22 A G 7: 30,569,389 (GRCm39) Y402H possibly damaging Het
Cd248 A G 19: 5,119,990 (GRCm39) T613A probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Cenpc1 A T 5: 86,194,405 (GRCm39) D120E probably benign Het
Chd3 T A 11: 69,250,656 (GRCm39) H691L probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
Ctnnd2 A T 15: 30,922,059 (GRCm39) E895V probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,585,108 (GRCm39) T837K probably benign Het
Eif2ak3 C A 6: 70,858,716 (GRCm39) probably benign Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Fat2 T A 11: 55,142,944 (GRCm39) M4302L probably benign Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Gde1 A T 7: 118,294,283 (GRCm39) F63L probably benign Het
Gjc3 A G 5: 137,956,202 (GRCm39) S28P probably benign Het
Gm10250 G A 15: 5,150,473 (GRCm39) probably null Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k11 T C 19: 5,740,843 (GRCm39) L190P probably damaging Het
Mki67 T A 7: 135,298,188 (GRCm39) Q2282L probably damaging Het
Mthfd2 T A 6: 83,285,990 (GRCm39) I272F probably damaging Het
Myom1 A T 17: 71,352,750 (GRCm39) D358V probably damaging Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Nebl T C 2: 17,395,737 (GRCm39) probably benign Het
Nlrp2 T A 7: 5,325,417 (GRCm39) N14Y possibly damaging Het
Or14a258 T C 7: 86,035,514 (GRCm39) Y118C probably damaging Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pld2 T G 11: 70,445,174 (GRCm39) N591K probably benign Het
Plekha7 A G 7: 115,769,939 (GRCm39) M276T probably damaging Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Prtg A G 9: 72,716,998 (GRCm39) Y113C probably damaging Het
Rab38 T A 7: 88,099,749 (GRCm39) I88N probably damaging Het
Rbfox2 A G 15: 76,976,057 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sec14l1 A T 11: 117,047,233 (GRCm39) K637I possibly damaging Het
Sh2b1 A T 7: 126,070,620 (GRCm39) D360E possibly damaging Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Tectb G T 19: 55,170,393 (GRCm39) K81N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Tiam1 T C 16: 89,694,642 (GRCm39) M272V probably benign Het
Trav13-3 T A 14: 53,967,233 (GRCm39) noncoding transcript Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43,355,567 (GRCm39) missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43,311,938 (GRCm39) missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43,302,628 (GRCm39) missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43,368,010 (GRCm39) missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43,291,693 (GRCm39) missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43,366,638 (GRCm39) missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43,320,590 (GRCm39) critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43,364,167 (GRCm39) missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43,334,205 (GRCm39) missense probably benign
IGL02456:Atp8b5 APN 4 43,365,578 (GRCm39) missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43,369,634 (GRCm39) missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43,366,770 (GRCm39) missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43,305,774 (GRCm39) missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43,369,715 (GRCm39) critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43,366,057 (GRCm39) missense probably benign
R0256:Atp8b5 UTSW 4 43,302,576 (GRCm39) intron probably benign
R0379:Atp8b5 UTSW 4 43,361,898 (GRCm39) missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43,291,672 (GRCm39) missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43,305,719 (GRCm39) intron probably benign
R1442:Atp8b5 UTSW 4 43,334,313 (GRCm39) missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43,302,590 (GRCm39) missense probably benign
R1469:Atp8b5 UTSW 4 43,291,733 (GRCm39) critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43,291,733 (GRCm39) critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43,344,430 (GRCm39) missense probably damaging 1.00
R1580:Atp8b5 UTSW 4 43,355,673 (GRCm39) missense possibly damaging 0.49
R1677:Atp8b5 UTSW 4 43,372,903 (GRCm39) missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43,372,906 (GRCm39) missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43,361,804 (GRCm39) missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43,357,063 (GRCm39) missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43,369,688 (GRCm39) missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43,370,726 (GRCm39) missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43,361,953 (GRCm39) splice site probably benign
R3023:Atp8b5 UTSW 4 43,311,957 (GRCm39) missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43,372,697 (GRCm39) missense probably benign
R3690:Atp8b5 UTSW 4 43,368,055 (GRCm39) missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43,365,591 (GRCm39) missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43,357,016 (GRCm39) missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43,320,629 (GRCm39) missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43,320,629 (GRCm39) missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43,365,955 (GRCm39) missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43,372,710 (GRCm39) missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43,308,504 (GRCm39) makesense probably null
R4784:Atp8b5 UTSW 4 43,356,980 (GRCm39) missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43,356,980 (GRCm39) missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43,344,449 (GRCm39) missense probably benign
R5422:Atp8b5 UTSW 4 43,366,644 (GRCm39) missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43,370,577 (GRCm39) missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43,304,674 (GRCm39) missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43,371,003 (GRCm39) missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43,334,249 (GRCm39) missense probably benign
R6931:Atp8b5 UTSW 4 43,364,108 (GRCm39) critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43,355,618 (GRCm39) missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43,361,835 (GRCm39) missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43,357,018 (GRCm39) missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43,342,640 (GRCm39) missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43,366,021 (GRCm39) missense probably benign
R7465:Atp8b5 UTSW 4 43,271,269 (GRCm39) missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43,366,609 (GRCm39) missense probably damaging 0.99
R7616:Atp8b5 UTSW 4 43,370,823 (GRCm39) critical splice donor site probably null
R7698:Atp8b5 UTSW 4 43,366,735 (GRCm39) missense probably benign 0.27
R7883:Atp8b5 UTSW 4 43,342,471 (GRCm39) missense probably damaging 0.99
R8052:Atp8b5 UTSW 4 43,356,982 (GRCm39) nonsense probably null
R8218:Atp8b5 UTSW 4 43,372,728 (GRCm39) critical splice donor site probably null
R8248:Atp8b5 UTSW 4 43,366,072 (GRCm39) missense probably damaging 0.97
R8345:Atp8b5 UTSW 4 43,291,714 (GRCm39) missense probably benign 0.01
R8756:Atp8b5 UTSW 4 43,342,439 (GRCm39) missense probably damaging 0.98
R8888:Atp8b5 UTSW 4 43,304,687 (GRCm39) missense
R8942:Atp8b5 UTSW 4 43,353,658 (GRCm39) missense probably damaging 1.00
R9153:Atp8b5 UTSW 4 43,308,493 (GRCm39) utr 3 prime probably benign
R9154:Atp8b5 UTSW 4 43,372,630 (GRCm39) missense probably benign 0.19
R9211:Atp8b5 UTSW 4 43,367,960 (GRCm39) missense probably damaging 0.97
R9361:Atp8b5 UTSW 4 43,369,658 (GRCm39) missense possibly damaging 0.80
R9786:Atp8b5 UTSW 4 43,305,798 (GRCm39) missense probably damaging 0.97
X0025:Atp8b5 UTSW 4 43,366,774 (GRCm39) missense probably damaging 1.00
Z1176:Atp8b5 UTSW 4 43,361,903 (GRCm39) missense probably benign 0.40
Z1177:Atp8b5 UTSW 4 43,370,669 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTTAGGTCAATCTTGGAAGCCCAGC -3'
(R):5'- TTAAGGTACTATGCCCACAGCCCC -3'

Sequencing Primer
(F):5'- AAGACTGGGACTCTGCATTAC -3'
(R):5'- ACCAAGTCTTGGCTCAGTG -3'
Posted On 2013-06-12