Incidental Mutation 'R5486:Plk3'
ID501054
Institutional Source Beutler Lab
Gene Symbol Plk3
Ensembl Gene ENSMUSG00000028680
Gene Namepolo like kinase 3
SynonymsCnk
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location117128655-117133963 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 117130403 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 412 (E412*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062206] [ENSMUST00000076859] [ENSMUST00000134074] [ENSMUST00000143213] [ENSMUST00000144269] [ENSMUST00000153257] [ENSMUST00000183310]
Predicted Effect probably benign
Transcript: ENSMUST00000062206
SMART Domains Protein: ENSMUSP00000052243
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:Tctex-1 121 217 3.7e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076859
AA Change: E451*
SMART Domains Protein: ENSMUSP00000076130
Gene: ENSMUSG00000028680
AA Change: E451*

DomainStartEndE-ValueType
low complexity region 9 36 N/A INTRINSIC
S_TKc 63 315 2.15e-96 SMART
Pfam:POLO_box 473 534 2.7e-16 PFAM
low complexity region 554 566 N/A INTRINSIC
Pfam:POLO_box 570 638 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126135
Predicted Effect probably benign
Transcript: ENSMUST00000134074
SMART Domains Protein: ENSMUSP00000114182
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143213
Predicted Effect probably benign
Transcript: ENSMUST00000144269
SMART Domains Protein: ENSMUSP00000122605
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:Tctex-1 118 178 1.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147730
AA Change: E412*
SMART Domains Protein: ENSMUSP00000120476
Gene: ENSMUSG00000028680
AA Change: E412*

DomainStartEndE-ValueType
low complexity region 1 9 N/A INTRINSIC
S_TKc 42 294 2.15e-96 SMART
Pfam:POLO_box 435 496 5.3e-17 PFAM
low complexity region 516 528 N/A INTRINSIC
Pfam:POLO_box 532 600 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153257
SMART Domains Protein: ENSMUSP00000121768
Gene: ENSMUSG00000073771

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:BACK 33 84 5e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183310
SMART Domains Protein: ENSMUSP00000138230
Gene: ENSMUSG00000073771

DomainStartEndE-ValueType
BTB 29 124 1.82e-18 SMART
BACK 129 233 4.17e-8 SMART
low complexity region 260 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the highly conserved polo-like kinase family of serine/threonine kinases. Members of this family are characterized by an amino-terminal catalytic domain and a carboxy-terminal bipartite polo box domain that functions as a substrate-binding motif and a cellular localization signal. Polo-like kinases have primarily been implicated in cell cycle regulation. In mouse, this protein that has been reported to localize to the nucleolus during interphase but is undetectable during mitosis, following nucleolus dissociation during prophase. The protein relocalizes to the nucleolus just prior to cytokinesis and peak levels are detected during G1 of interphase. This gene has been implicated in regulation of entry into S phase, with RNAi-induced depletion resulting in failure to re-enter the cell cycle. Mice deficient for this gene exhibit increased weight and tumor development at advanced age. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Aged mice homozygous for a null allele develop tumors in various organs at an accelerated rate while mouse embryonic fibroblasts are hypersensitive to the induction of HIF-1alpha under hypoxic conditions or by nickel and cobalt ion treatments. Homozygotes for another null allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Plk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Plk3 APN 4 117132997 nonsense probably null
IGL01647:Plk3 APN 4 117130357 missense probably damaging 1.00
IGL02516:Plk3 APN 4 117131989 missense probably damaging 0.99
IGL03340:Plk3 APN 4 117132928 missense probably damaging 0.98
PIT4283001:Plk3 UTSW 4 117133292 missense probably damaging 1.00
R0421:Plk3 UTSW 4 117133444 missense probably damaging 1.00
R1074:Plk3 UTSW 4 117131758 missense probably damaging 1.00
R1612:Plk3 UTSW 4 117131807 missense probably damaging 1.00
R3813:Plk3 UTSW 4 117133450 missense probably damaging 1.00
R3901:Plk3 UTSW 4 117133436 missense probably benign 0.13
R5232:Plk3 UTSW 4 117129120 missense probably benign 0.04
R5655:Plk3 UTSW 4 117131480 missense probably damaging 1.00
R6612:Plk3 UTSW 4 117132737 nonsense probably null
R7127:Plk3 UTSW 4 117130570 missense probably benign 0.39
R7380:Plk3 UTSW 4 117131153 missense probably benign
R7748:Plk3 UTSW 4 117131728 missense probably damaging 1.00
R7839:Plk3 UTSW 4 117129330 missense probably damaging 1.00
R7922:Plk3 UTSW 4 117129330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGTATTGTGGTACCCAG -3'
(R):5'- AAGAAGGTTTGACTGTGGCCAC -3'

Sequencing Primer
(F):5'- TATTGTGGTACCCAGCAAGC -3'
(R):5'- ACAGTGGTAGAGTCTGCCCTC -3'
Posted On2017-12-01