Incidental Mutation 'R5487:Tmbim1'
ID501056
Institutional Source Beutler Lab
Gene Symbol Tmbim1
Ensembl Gene ENSMUSG00000006301
Gene Nametransmembrane BAX inhibitor motif containing 1
Synonyms
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R5487 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74288247-74305622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74293005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 121 (V121A)
Ref Sequence ENSEMBL: ENSMUSP00000109427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016309] [ENSMUST00000027370] [ENSMUST00000087226] [ENSMUST00000113796] [ENSMUST00000130763] [ENSMUST00000141560]
Predicted Effect probably benign
Transcript: ENSMUST00000016309
AA Change: V121A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000016309
Gene: ENSMUSG00000006301
AA Change: V121A

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Pfam:Bax1-I 94 305 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027370
SMART Domains Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 1e-24 BLAST
Lactamase_B 129 291 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087226
SMART Domains Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Pfam:DUF4748 71 121 2.9e-23 PFAM
Lactamase_B 168 330 1.05e-31 SMART
Pfam:HAGH_C 331 421 6.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113796
AA Change: V121A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109427
Gene: ENSMUSG00000006301
AA Change: V121A

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Pfam:Bax1-I 94 305 4.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128505
SMART Domains Protein: ENSMUSP00000122874
Gene: ENSMUSG00000006301

DomainStartEndE-ValueType
Pfam:Bax1-I 1 152 3.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130763
SMART Domains Protein: ENSMUSP00000121814
Gene: ENSMUSG00000006301

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138620
Predicted Effect probably benign
Transcript: ENSMUST00000141560
SMART Domains Protein: ENSMUSP00000115444
Gene: ENSMUSG00000006301

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187941
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit susceptibility to cystic medial degeneration without inflammation or change in blood pressure and are prone to aortic dilation with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Tmbim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Tmbim1 APN 1 74295263 missense probably damaging 1.00
IGL03062:Tmbim1 APN 1 74291699 missense possibly damaging 0.63
IGL03306:Tmbim1 APN 1 74293066 missense probably damaging 1.00
R0987:Tmbim1 UTSW 1 74293924 unclassified probably null
R1067:Tmbim1 UTSW 1 74290746 unclassified probably benign
R3821:Tmbim1 UTSW 1 74293930 missense probably damaging 1.00
R3881:Tmbim1 UTSW 1 74289998 unclassified probably benign
R4254:Tmbim1 UTSW 1 74293931 missense probably damaging 1.00
R4787:Tmbim1 UTSW 1 74295360 missense possibly damaging 0.74
R4906:Tmbim1 UTSW 1 74289409 missense probably damaging 1.00
R4949:Tmbim1 UTSW 1 74295365 missense probably damaging 1.00
R6257:Tmbim1 UTSW 1 74293066 missense probably damaging 1.00
R7347:Tmbim1 UTSW 1 74291279 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGTTCTGCCCTGAACAACG -3'
(R):5'- GTACCACTAGCATGTTGGGG -3'

Sequencing Primer
(F):5'- TGAACAACGCCGGTCAG -3'
(R):5'- CCACTAGCATGTTGGGGGTGAG -3'
Posted On2017-12-01