Incidental Mutation 'R5500:Kif18b'
ID501063
Institutional Source Beutler Lab
Gene Symbol Kif18b
Ensembl Gene ENSMUSG00000051378
Gene Namekinesin family member 18B
Synonyms3000004C01Rik, N-8 kinesin
MMRRC Submission 043061-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5500 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102905529-102925124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102915700 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 107 (V107E)
Ref Sequence ENSEMBL: ENSMUSP00000021311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021311]
Predicted Effect probably damaging
Transcript: ENSMUST00000021311
AA Change: V107E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021311
Gene: ENSMUSG00000051378
AA Change: V107E

DomainStartEndE-ValueType
KISc 7 361 1.47e-158 SMART
coiled coil region 368 404 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
low complexity region 676 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,389 Q864L probably benign Het
AI182371 A G 2: 35,100,638 S16P probably damaging Het
Amy1 A T 3: 113,562,722 Y262N probably damaging Het
Cdh23 T C 10: 60,314,311 D2583G probably damaging Het
Ddx60 A G 8: 61,950,451 K303E probably benign Het
Dis3l2 T C 1: 87,021,119 probably null Het
Evi5l T A 8: 4,191,658 M329K probably damaging Het
Fam169b A G 7: 68,350,369 D221G probably damaging Het
Farsb T C 1: 78,471,124 D126G probably damaging Het
Gm4847 A G 1: 166,635,042 I293T probably damaging Het
Gm4951 G A 18: 60,246,020 R209H probably damaging Het
Ighmbp2 T C 19: 3,268,687 H463R possibly damaging Het
Kank1 A T 19: 25,424,332 D1101V possibly damaging Het
Kcnh8 G A 17: 52,725,980 M98I probably benign Het
Kdsr A G 1: 106,759,644 probably benign Het
Klhl41 A G 2: 69,683,529 E584G probably damaging Het
Kpnb1 G A 11: 97,173,111 A389V possibly damaging Het
Krtap31-2 A G 11: 99,936,347 T2A possibly damaging Het
Lama3 A T 18: 12,456,764 I784F possibly damaging Het
Lpar1 G A 4: 58,486,573 R233C probably benign Het
Neb C A 2: 52,162,067 probably null Het
Neo1 A G 9: 58,917,054 I697T possibly damaging Het
Pgm2l1 T G 7: 100,268,133 S486A probably benign Het
Prpf40a A T 2: 53,145,284 S748R probably benign Het
Recql4 A G 15: 76,705,578 probably benign Het
Rhbdl1 T C 17: 25,836,554 T20A possibly damaging Het
Ric8a T C 7: 140,858,315 Y156H probably benign Het
Rnf111 C A 9: 70,476,043 G203C possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc2a12 G A 10: 22,665,137 G297E probably damaging Het
Slc35f1 A T 10: 52,933,222 I102F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slitrk3 T C 3: 73,050,347 Y364C probably damaging Het
Tdrd9 T C 12: 112,023,268 Y505H probably benign Het
Tlr1 G T 5: 64,927,098 D45E probably benign Het
Upp1 G A 11: 9,131,774 V104M probably damaging Het
Usp9y A G Y: 1,341,875 V1330A probably damaging Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zbed5 T A 5: 129,901,982 Y257* probably null Het
Other mutations in Kif18b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Kif18b APN 11 102914675 missense probably damaging 0.99
IGL01570:Kif18b APN 11 102912391 missense probably benign 0.04
IGL02965:Kif18b APN 11 102916512 start gained probably benign
IGL02997:Kif18b APN 11 102909084 missense probably damaging 1.00
IGL03135:Kif18b APN 11 102914260 missense probably damaging 1.00
IGL02988:Kif18b UTSW 11 102908320 missense probably damaging 1.00
R0541:Kif18b UTSW 11 102915175 missense probably damaging 0.98
R1446:Kif18b UTSW 11 102914699 missense probably damaging 0.99
R1674:Kif18b UTSW 11 102913060 missense probably benign 0.04
R1729:Kif18b UTSW 11 102915541 critical splice donor site probably null
R1784:Kif18b UTSW 11 102915541 critical splice donor site probably null
R2249:Kif18b UTSW 11 102912388 missense probably benign 0.01
R2291:Kif18b UTSW 11 102908270 missense probably damaging 1.00
R3723:Kif18b UTSW 11 102916276 missense probably damaging 1.00
R5496:Kif18b UTSW 11 102913742 missense possibly damaging 0.88
R5598:Kif18b UTSW 11 102908189 missense possibly damaging 0.89
R5820:Kif18b UTSW 11 102913048 missense probably benign 0.00
R5910:Kif18b UTSW 11 102913544 missense probably benign
R5912:Kif18b UTSW 11 102912991 missense probably benign
R6394:Kif18b UTSW 11 102914410 missense probably damaging 1.00
R6541:Kif18b UTSW 11 102914266 missense probably damaging 1.00
R6911:Kif18b UTSW 11 102916380 missense probably damaging 0.96
R7467:Kif18b UTSW 11 102916408 missense probably damaging 1.00
R7526:Kif18b UTSW 11 102914667 missense probably damaging 1.00
R7581:Kif18b UTSW 11 102914722 missense probably damaging 1.00
Z1088:Kif18b UTSW 11 102908157 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGAAGTGTGACATGGGCC -3'
(R):5'- CCAGTGCAGATCCTACTGAC -3'

Sequencing Primer
(F):5'- TGTGACATGGGCCAGAGC -3'
(R):5'- GTGCAGATCCTACTGACCAGAAG -3'
Posted On2017-12-01