Incidental Mutation 'R5456:Mfsd1'
ID501066
Institutional Source Beutler Lab
Gene Symbol Mfsd1
Ensembl Gene ENSMUSG00000027775
Gene Namemajor facilitator superfamily domain containing 1
Synonyms1200003O06Rik
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location67582741-67604237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67589833 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 147 (I147T)
Ref Sequence ENSEMBL: ENSMUSP00000029344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029344]
Predicted Effect probably benign
Transcript: ENSMUST00000029344
AA Change: I147T

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029344
Gene: ENSMUSG00000027775
AA Change: I147T

DomainStartEndE-ValueType
Pfam:MFS_1 45 404 2.3e-31 PFAM
Pfam:MFS_2 175 443 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192776
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Mfsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01781:Mfsd1 APN 3 67587911 splice site probably benign
IGL02186:Mfsd1 APN 3 67596595 missense probably benign 0.00
IGL02209:Mfsd1 APN 3 67598132 splice site probably benign
IGL02293:Mfsd1 APN 3 67598092 missense probably damaging 1.00
IGL03132:Mfsd1 APN 3 67587940 missense possibly damaging 0.53
edelweiss UTSW 3 67596603 nonsense probably null
Schneeweiss UTSW 3 67585662 missense possibly damaging 0.79
white UTSW 3 67589829 critical splice acceptor site probably null
R0948:Mfsd1 UTSW 3 67596734 missense possibly damaging 0.61
R2355:Mfsd1 UTSW 3 67601335 missense probably damaging 1.00
R3407:Mfsd1 UTSW 3 67596713 missense possibly damaging 0.70
R3408:Mfsd1 UTSW 3 67596713 missense possibly damaging 0.70
R3729:Mfsd1 UTSW 3 67582965 missense probably benign 0.03
R3749:Mfsd1 UTSW 3 67582953 missense probably benign 0.09
R4405:Mfsd1 UTSW 3 67600610 missense probably benign 0.07
R4867:Mfsd1 UTSW 3 67587987 critical splice donor site probably null
R5429:Mfsd1 UTSW 3 67599960 missense probably damaging 1.00
R5892:Mfsd1 UTSW 3 67589829 critical splice acceptor site probably null
R6091:Mfsd1 UTSW 3 67599937 splice site probably null
R6120:Mfsd1 UTSW 3 67594385 nonsense probably null
R6671:Mfsd1 UTSW 3 67585662 missense possibly damaging 0.79
R6752:Mfsd1 UTSW 3 67596603 nonsense probably null
R6799:Mfsd1 UTSW 3 67599981 missense probably damaging 0.97
R7117:Mfsd1 UTSW 3 67600058 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGTCAGTTGCCATCTTTGTCATG -3'
(R):5'- ACATCCAAGTGTGCTCTAGC -3'

Sequencing Primer
(F):5'- GTCATGCTCATGGTCACACAG -3'
(R):5'- GCACACTTCTTTCTATGACTGAAGAG -3'
Posted On2017-12-01