Mutagenetix > Incidental Mutation

Incidental Mutation 'R5468:Lamc1'

501076

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

MMRRC Submission

043029-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5468 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 153233564 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1161 (S1161P)

Ref Sequence

ENSEMBL: ENSMUSP00000027752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000027752
AA Change: S1161P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: S1161P

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160515

Predicted Effect

probably benign
Transcript: ENSMUST00000161744

SMART Domains

Protein: ENSMUSP00000124662
Gene: ENSMUSG00000026478

Domain	Start	End	E-Value	Type
coiled coil region	1	73	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000163011
AA Change: S93P

SMART Domains

Protein: ENSMUSP00000124216
Gene: ENSMUSG00000026478
AA Change: S93P

Domain	Start	End	E-Value	Type
coiled coil region	1	93	N/A	INTRINSIC

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.2%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008O03Rik	C	T	7: 44,360,235	R181Q	probably damaging	Het
Abca13	T	A	11: 9,294,062	L1975Q	probably damaging	Het
Acp2	T	A	2: 91,206,098	I180N	probably benign	Het
Adam12	T	C	7: 133,975,473	D221G	probably damaging	Het
Adamts4	A	G	1: 171,252,609	T244A	probably benign	Het
Adrb2	A	T	18: 62,179,625	I43N	probably damaging	Het
Anxa1	A	T	19: 20,378,483	Y207N	probably damaging	Het
Apba2	T	C	7: 64,745,762	L662P	probably damaging	Het
Arhgap18	T	A	10: 26,912,671	I593K	probably damaging	Het
Arsj	T	C	3: 126,438,388	V261A	possibly damaging	Het
Atp7b	A	T	8: 22,059,970		probably null	Het
C2cd2	C	T	16: 97,868,591		probably null	Het
C530008M17Rik	A	T	5: 76,840,763		probably benign	Het
Cenpf	A	T	1: 189,652,371	S2571T	probably damaging	Het
Cep162	A	C	9: 87,227,237	L438V	probably benign	Het
Cfap74	A	T	4: 155,426,041	N361I	probably benign	Het
Cntn5	A	G	9: 9,743,628	I548T	probably damaging	Het
Dglucy	A	G	12: 100,850,335	N382S	probably benign	Het
Dnah10	C	A	5: 124,830,493	N4306K	probably damaging	Het
Fam181a	A	T	12: 103,316,678	M281L	probably benign	Het
Fam186b	A	G	15: 99,278,870	I713T	possibly damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Fry	A	T	5: 150,399,588	Y1068F	probably benign	Het
Fubp3	A	G	2: 31,603,235	I231V	probably benign	Het
Gbf1	A	G	19: 46,284,296	D1681G	possibly damaging	Het
Gm10999	G	A	8: 129,131,649	P5S	probably damaging	Het
Gm12689	T	C	4: 99,296,165	I85T	unknown	Het
Impg1	T	C	9: 80,465,265	I9V	probably benign	Het
Lama4	A	G	10: 39,072,682		probably null	Het
Lipm	T	A	19: 34,109,554		probably null	Het
Lrrc7	G	T	3: 158,318,436	N107K	probably damaging	Het
Lypd8	T	C	11: 58,386,760	S123P	probably damaging	Het
Man2a2	T	C	7: 80,352,981	D1084G	probably damaging	Het
Man2b2	A	G	5: 36,807,175	S1000P	probably benign	Het
Ms4a7	C	T	19: 11,322,414	C71Y	probably benign	Het
Mtus1	A	G	8: 41,084,578	S34P	probably benign	Het
Myo3b	A	G	2: 70,234,441	N406S	probably benign	Het
Nbr1	A	T	11: 101,572,464	M586L	probably benign	Het
Nfatc1	C	T	18: 80,649,855	R677H	probably benign	Het
Nlrc3	A	C	16: 3,964,035	S503R	probably damaging	Het
Nlrp9c	A	T	7: 26,365,000	F968I	probably benign	Het
Olfr340	A	T	2: 36,453,443	N286I	probably damaging	Het
Olfr881	G	A	9: 37,993,011	C168Y	probably damaging	Het
Olfr951	A	G	9: 39,393,961	N57D	probably benign	Het
Onecut1	A	T	9: 74,863,332	T346S	probably damaging	Het
Pclo	A	T	5: 14,680,952	K3156M	unknown	Het
Pigo	C	T	4: 43,024,562		probably null	Het
Plcb4	T	C	2: 135,967,152	F580S	probably damaging	Het
Plekhm2	G	T	4: 141,628,100	P879H	probably damaging	Het
Ppm1e	T	A	11: 87,230,890	Y747F	probably benign	Het
Ppwd1	A	G	13: 104,225,444	F69L	possibly damaging	Het
Prss27	C	A	17: 24,038,313	Q3K	possibly damaging	Het
Prss29	T	A	17: 25,321,046	N139K	possibly damaging	Het
Qrich2	T	A	11: 116,448,365	T1777S	probably damaging	Het
Rbp3	A	T	14: 33,956,627	H844L	possibly damaging	Het
Rubcnl	G	A	14: 75,032,031	C43Y	possibly damaging	Het
Sec14l5	A	G	16: 5,167,140		probably null	Het
Sepsecs	A	T	5: 52,644,014	N435K	probably damaging	Het
Sfrp1	A	G	8: 23,446,210	K223E	probably benign	Het
Sh3tc2	G	A	18: 61,973,431		probably null	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Tmprss7	A	G	16: 45,656,448	F817S	probably damaging	Het
Tril	T	C	6: 53,819,647	N197D	probably damaging	Het
Tspan18	T	C	2: 93,209,862	T183A	probably benign	Het
Uroc1	A	T	6: 90,338,604	M156L	probably benign	Het
Wnt16	T	C	6: 22,291,161	V196A	probably benign	Het
Xpnpep1	A	G	19: 52,995,519	Y592H	probably benign	Het
Zfp553	T	C	7: 127,237,030	S586P	probably benign	Het
Zfp619	C	T	7: 39,535,728	A394V	unknown	Het
Zfp985	A	G	4: 147,583,245	Y190C	probably benign	Het
Zmynd10	T	A	9: 107,550,337	D309E	probably benign	Het
Zmynd15	T	C	11: 70,461,820	L73P	probably damaging	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0157:Lamc1	UTSW	1	153262607	missense	probably benign	0.00
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1481:Lamc1	UTSW	1	153221634	missense	probably damaging	1.00
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1583:Lamc1	UTSW	1	153243478	critical splice acceptor site	probably null
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4650:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6431:Lamc1	UTSW	1	153221671	missense	probably benign	0.21
R6636:Lamc1	UTSW	1	153241975	missense	possibly damaging	0.93
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7388:Lamc1	UTSW	1	153249076	missense	probably damaging	1.00
R7474:Lamc1	UTSW	1	153332265	missense	possibly damaging	0.81
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8315:Lamc1	UTSW	1	153243421	missense	probably benign	0.00
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R8995:Lamc1	UTSW	1	153332247	missense	probably benign	0.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTAAACCTCAATGGAAAGTAGCC -3'
(R):5'- AACTGAGAGATGTCTAGGCTCTTTC -3'

Sequencing Primer
(F):5'- CTCAATGGAAAGTAGCCGTGGG -3'
(R):5'- AGAGATGTCTAGGCTCTTTCTCTTAC -3'

Posted On

2017-12-01