Incidental Mutation 'R5468:Lrrc7'
ID501077
Institutional Source Beutler Lab
Gene Symbol Lrrc7
Ensembl Gene ENSMUSG00000028176
Gene Nameleucine rich repeat containing 7
Synonymsdensin
MMRRC Submission 043029-MU
Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R5468 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location158082891-158562221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 158318436 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 107 (N107K)
Ref Sequence ENSEMBL: ENSMUSP00000142498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]
Predicted Effect probably damaging
Transcript: ENSMUST00000106044
AA Change: N107K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: N107K

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1349 1378 2e-11 BLAST
PDZ 1460 1540 1.33e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199890
AA Change: N107K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: N107K

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 9e-6 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1328 1364 1e-15 BLAST
low complexity region 1374 1387 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200137
AA Change: N107K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: N107K

DomainStartEndE-ValueType
LRR 52 69 7.6e-1 SMART
LRR 73 92 4.2e-1 SMART
LRR 96 115 3.4e-1 SMART
LRR 142 164 1.8e-1 SMART
LRR 165 184 1.5e-1 SMART
LRR 188 207 2e-2 SMART
LRR 211 233 1.3e-1 SMART
LRR 234 257 1.7e-1 SMART
LRR 257 276 1e0 SMART
LRR 280 299 3.1e-2 SMART
LRR 303 322 6.6e-1 SMART
LRR 326 345 2.1e-1 SMART
LRR 372 391 1.2e-1 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1302 1331 2e-11 BLAST
PDZ 1413 1493 6.4e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200196
AA Change: N95K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik C T 7: 44,360,235 R181Q probably damaging Het
Abca13 T A 11: 9,294,062 L1975Q probably damaging Het
Acp2 T A 2: 91,206,098 I180N probably benign Het
Adam12 T C 7: 133,975,473 D221G probably damaging Het
Adamts4 A G 1: 171,252,609 T244A probably benign Het
Adrb2 A T 18: 62,179,625 I43N probably damaging Het
Anxa1 A T 19: 20,378,483 Y207N probably damaging Het
Apba2 T C 7: 64,745,762 L662P probably damaging Het
Arhgap18 T A 10: 26,912,671 I593K probably damaging Het
Arsj T C 3: 126,438,388 V261A possibly damaging Het
Atp7b A T 8: 22,059,970 probably null Het
C2cd2 C T 16: 97,868,591 probably null Het
C530008M17Rik A T 5: 76,840,763 probably benign Het
Cenpf A T 1: 189,652,371 S2571T probably damaging Het
Cep162 A C 9: 87,227,237 L438V probably benign Het
Cfap74 A T 4: 155,426,041 N361I probably benign Het
Cntn5 A G 9: 9,743,628 I548T probably damaging Het
Dglucy A G 12: 100,850,335 N382S probably benign Het
Dnah10 C A 5: 124,830,493 N4306K probably damaging Het
Fam181a A T 12: 103,316,678 M281L probably benign Het
Fam186b A G 15: 99,278,870 I713T possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fry A T 5: 150,399,588 Y1068F probably benign Het
Fubp3 A G 2: 31,603,235 I231V probably benign Het
Gbf1 A G 19: 46,284,296 D1681G possibly damaging Het
Gm10999 G A 8: 129,131,649 P5S probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Impg1 T C 9: 80,465,265 I9V probably benign Het
Lama4 A G 10: 39,072,682 probably null Het
Lamc1 A G 1: 153,233,564 S1161P probably damaging Het
Lipm T A 19: 34,109,554 probably null Het
Lypd8 T C 11: 58,386,760 S123P probably damaging Het
Man2a2 T C 7: 80,352,981 D1084G probably damaging Het
Man2b2 A G 5: 36,807,175 S1000P probably benign Het
Ms4a7 C T 19: 11,322,414 C71Y probably benign Het
Mtus1 A G 8: 41,084,578 S34P probably benign Het
Myo3b A G 2: 70,234,441 N406S probably benign Het
Nbr1 A T 11: 101,572,464 M586L probably benign Het
Nfatc1 C T 18: 80,649,855 R677H probably benign Het
Nlrc3 A C 16: 3,964,035 S503R probably damaging Het
Nlrp9c A T 7: 26,365,000 F968I probably benign Het
Olfr340 A T 2: 36,453,443 N286I probably damaging Het
Olfr881 G A 9: 37,993,011 C168Y probably damaging Het
Olfr951 A G 9: 39,393,961 N57D probably benign Het
Onecut1 A T 9: 74,863,332 T346S probably damaging Het
Pclo A T 5: 14,680,952 K3156M unknown Het
Pigo C T 4: 43,024,562 probably null Het
Plcb4 T C 2: 135,967,152 F580S probably damaging Het
Plekhm2 G T 4: 141,628,100 P879H probably damaging Het
Ppm1e T A 11: 87,230,890 Y747F probably benign Het
Ppwd1 A G 13: 104,225,444 F69L possibly damaging Het
Prss27 C A 17: 24,038,313 Q3K possibly damaging Het
Prss29 T A 17: 25,321,046 N139K possibly damaging Het
Qrich2 T A 11: 116,448,365 T1777S probably damaging Het
Rbp3 A T 14: 33,956,627 H844L possibly damaging Het
Rubcnl G A 14: 75,032,031 C43Y possibly damaging Het
Sec14l5 A G 16: 5,167,140 probably null Het
Sepsecs A T 5: 52,644,014 N435K probably damaging Het
Sfrp1 A G 8: 23,446,210 K223E probably benign Het
Sh3tc2 G A 18: 61,973,431 probably null Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Tmprss7 A G 16: 45,656,448 F817S probably damaging Het
Tril T C 6: 53,819,647 N197D probably damaging Het
Tspan18 T C 2: 93,209,862 T183A probably benign Het
Uroc1 A T 6: 90,338,604 M156L probably benign Het
Wnt16 T C 6: 22,291,161 V196A probably benign Het
Xpnpep1 A G 19: 52,995,519 Y592H probably benign Het
Zfp553 T C 7: 127,237,030 S586P probably benign Het
Zfp619 C T 7: 39,535,728 A394V unknown Het
Zfp985 A G 4: 147,583,245 Y190C probably benign Het
Zmynd10 T A 9: 107,550,337 D309E probably benign Het
Zmynd15 T C 11: 70,461,820 L73P probably damaging Het
Other mutations in Lrrc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Lrrc7 APN 3 158187010 missense probably benign 0.07
IGL00644:Lrrc7 APN 3 158202368 nonsense probably null
IGL00822:Lrrc7 APN 3 158185474 missense probably damaging 0.99
IGL00927:Lrrc7 APN 3 158161090 missense possibly damaging 0.94
IGL00946:Lrrc7 APN 3 158161356 missense probably benign 0.07
IGL00948:Lrrc7 APN 3 158161557 missense probably damaging 1.00
IGL01838:Lrrc7 APN 3 158185463 missense probably damaging 1.00
IGL01874:Lrrc7 APN 3 158240443 splice site probably benign
IGL02514:Lrrc7 APN 3 158160292 missense probably damaging 0.96
IGL02545:Lrrc7 APN 3 158185374 splice site probably benign
IGL02665:Lrrc7 APN 3 158161105 missense probably damaging 0.99
IGL03129:Lrrc7 APN 3 158161059 missense probably benign 0.02
N/A:Lrrc7 UTSW 3 158160340 missense probably benign
R0021:Lrrc7 UTSW 3 158160661 missense probably damaging 1.00
R0041:Lrrc7 UTSW 3 158164260 splice site probably benign
R0255:Lrrc7 UTSW 3 158160838 nonsense probably null
R0278:Lrrc7 UTSW 3 158179795 missense possibly damaging 0.96
R0409:Lrrc7 UTSW 3 158161426 missense possibly damaging 0.59
R0612:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R0866:Lrrc7 UTSW 3 158164266 splice site probably benign
R1077:Lrrc7 UTSW 3 158161143 missense probably damaging 1.00
R1103:Lrrc7 UTSW 3 158148706 splice site probably benign
R1157:Lrrc7 UTSW 3 158160255 missense probably damaging 1.00
R1187:Lrrc7 UTSW 3 158160402 missense probably damaging 1.00
R1301:Lrrc7 UTSW 3 158135331 missense probably benign 0.20
R1433:Lrrc7 UTSW 3 158177306 missense probably damaging 1.00
R1450:Lrrc7 UTSW 3 158187044 missense possibly damaging 0.62
R1595:Lrrc7 UTSW 3 158177277 nonsense probably null
R1659:Lrrc7 UTSW 3 158161408 missense probably damaging 1.00
R1693:Lrrc7 UTSW 3 158084533 missense possibly damaging 0.95
R1774:Lrrc7 UTSW 3 158160292 missense possibly damaging 0.88
R2273:Lrrc7 UTSW 3 158187059 missense probably damaging 1.00
R2276:Lrrc7 UTSW 3 158179792 missense probably damaging 1.00
R2302:Lrrc7 UTSW 3 158135244 missense probably damaging 0.99
R2326:Lrrc7 UTSW 3 158170661 missense probably damaging 1.00
R2371:Lrrc7 UTSW 3 158161060 missense probably damaging 0.99
R2383:Lrrc7 UTSW 3 158163956 missense probably benign
R2679:Lrrc7 UTSW 3 158175108 nonsense probably null
R2698:Lrrc7 UTSW 3 158135391 missense probably benign 0.22
R2858:Lrrc7 UTSW 3 158161725 missense probably damaging 0.99
R3758:Lrrc7 UTSW 3 158163965 missense probably damaging 1.00
R3791:Lrrc7 UTSW 3 158163956 missense probably benign
R3805:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3806:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3807:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3892:Lrrc7 UTSW 3 158160696 missense probably benign 0.08
R3912:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3913:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3963:Lrrc7 UTSW 3 158160405 missense probably damaging 1.00
R4665:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4666:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4671:Lrrc7 UTSW 3 158202495 critical splice acceptor site probably null
R4688:Lrrc7 UTSW 3 158148605 missense probably damaging 1.00
R4725:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4726:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4728:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4783:Lrrc7 UTSW 3 158127213 critical splice donor site probably null
R4867:Lrrc7 UTSW 3 158161005 missense probably damaging 1.00
R4907:Lrrc7 UTSW 3 158161240 missense probably damaging 1.00
R5032:Lrrc7 UTSW 3 158181580 missense possibly damaging 0.85
R5107:Lrrc7 UTSW 3 158161896 missense probably damaging 1.00
R5295:Lrrc7 UTSW 3 158170739 missense probably damaging 1.00
R5348:Lrrc7 UTSW 3 158175326 missense probably benign 0.02
R5778:Lrrc7 UTSW 3 158170743 missense probably damaging 1.00
R5897:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R6179:Lrrc7 UTSW 3 158353432 missense probably damaging 0.99
R6312:Lrrc7 UTSW 3 158160609 missense probably benign 0.04
R6313:Lrrc7 UTSW 3 158160736 missense probably damaging 1.00
R6366:Lrrc7 UTSW 3 158135375 missense probably benign 0.04
R6389:Lrrc7 UTSW 3 158185426 missense probably damaging 1.00
R6638:Lrrc7 UTSW 3 158135303 missense probably benign 0.20
R6956:Lrrc7 UTSW 3 158289031 missense probably benign 0.02
R6969:Lrrc7 UTSW 3 158156913 missense probably benign 0.19
R7073:Lrrc7 UTSW 3 158127247 missense probably damaging 1.00
R7313:Lrrc7 UTSW 3 158160474 missense probably damaging 1.00
R7365:Lrrc7 UTSW 3 158198161 missense probably damaging 1.00
R7398:Lrrc7 UTSW 3 158291958 nonsense probably null
R7403:Lrrc7 UTSW 3 158148674 nonsense probably null
R7407:Lrrc7 UTSW 3 158135241 missense probably damaging 1.00
R7427:Lrrc7 UTSW 3 158198141 missense probably benign 0.06
R7453:Lrrc7 UTSW 3 158185409 missense probably benign 0.00
R7461:Lrrc7 UTSW 3 158187020 missense probably benign 0.00
R7807:Lrrc7 UTSW 3 158160487 missense probably damaging 1.00
R7872:Lrrc7 UTSW 3 158353462 missense probably damaging 0.99
R8215:Lrrc7 UTSW 3 158209750 missense probably benign
R8367:Lrrc7 UTSW 3 158202370 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATGCTCTGAAAATGAGGATGAACC -3'
(R):5'- AGTGAGTCTAGCCAAACTGTG -3'

Sequencing Primer
(F):5'- TAGAATGCATATCTGAGTTGAGTGAG -3'
(R):5'- CCAAACTGTGGCCTAACTAGTGAG -3'
Posted On2017-12-01