Mutagenetix > Incidental Mutation

Incidental Mutation 'R0130:Paxip1'

50108

Institutional Source

Beutler Lab

Gene Symbol

Paxip1

Ensembl Gene

ENSMUSG00000002221

Gene Name

PAX interacting (with transcription-activation domain) protein 1

Synonyms

D5Ertd149e, PTIP

MMRRC Submission

038415-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0130 (G1)

Quality Score

155

Status

Validated (trace)

Chromosome

Chromosomal Location

27740080-27791691 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 27744185 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000002291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002291]

AlphaFold

Q6NZQ4

Predicted Effect

probably benign
Transcript: ENSMUST00000002291

SMART Domains

Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221

Domain	Start	End	E-Value	Type
BRCT	10	83	6.72e1	SMART
BRCT	96	173	8.83e-15	SMART
low complexity region	189	208	N/A	INTRINSIC
low complexity region	214	223	N/A	INTRINSIC
coiled coil region	489	547	N/A	INTRINSIC
BRCT	590	671	5.74e-14	SMART
BRCT	690	766	1.67e-15	SMART
BRCT	845	924	4.03e-9	SMART
BRCT	957	1046	3.54e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197625

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 97.7%
10x: 93.4%
20x: 80.2%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg8	A	T	17: 84,686,666	Y37F	probably damaging	Het
Ablim2	G	A	5: 35,809,176		probably benign	Het
Anxa9	A	G	3: 95,302,422	S129P	probably benign	Het
Apol7c	A	G	15: 77,526,362	I128T	possibly damaging	Het
Arfgef2	T	G	2: 166,835,719	I88S	probably damaging	Het
Arfip2	A	G	7: 105,638,998		probably benign	Het
Atp5j2	A	T	5: 145,188,182		probably benign	Het
Atp7b	C	T	8: 22,028,172	E205K	possibly damaging	Het
Atp8b5	T	A	4: 43,369,715		probably null	Het
Cd22	A	G	7: 30,869,964	Y402H	possibly damaging	Het
Cd248	A	G	19: 5,069,962	T613A	probably benign	Het
Cdcp2	C	T	4: 107,106,707		probably benign	Het
Cenpc1	A	T	5: 86,046,546	D120E	probably benign	Het
Chd3	T	A	11: 69,359,830	H691L	probably damaging	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cped1	T	A	6: 22,121,039	Y373N	probably benign	Het
Cr2	A	T	1: 195,166,231	V328D	probably damaging	Het
Ctnnd2	A	T	15: 30,921,913	E895V	probably damaging	Het
D630045J12Rik	A	T	6: 38,149,771		probably benign	Het
Dcdc2a	A	T	13: 25,187,672		probably benign	Het
Dync1h1	C	A	12: 110,618,674	T837K	probably benign	Het
Eif2ak3	C	A	6: 70,881,732		probably benign	Het
Epb41l5	A	C	1: 119,549,902	V705G	possibly damaging	Het
Fat2	T	A	11: 55,252,118	M4302L	probably benign	Het
Flnb	T	C	14: 7,901,951	V938A	probably damaging	Het
Frmd4a	T	C	2: 4,604,092	Y928H	probably damaging	Het
Fyn	C	T	10: 39,511,982	T78M	probably benign	Het
Gdap2	A	G	3: 100,201,995	T443A	probably damaging	Het
Gde1	A	T	7: 118,695,060	F63L	probably benign	Het
Gjc3	A	G	5: 137,957,940	S28P	probably benign	Het
Gm10250	G	A	15: 5,120,991		probably null	Het
Gm1141	T	C	X: 71,939,555	C378R	possibly damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Klhl23	T	C	2: 69,833,966	V553A	probably damaging	Het
Lman2l	G	T	1: 36,424,864	S171*	probably null	Het
Lrp1b	T	C	2: 41,511,508	D378G	probably damaging	Het
Map3k11	T	C	19: 5,690,815	L190P	probably damaging	Het
Mki67	T	A	7: 135,696,459	Q2282L	probably damaging	Het
Mthfd2	T	A	6: 83,309,008	I272F	probably damaging	Het
Myom1	A	T	17: 71,045,755	D358V	probably damaging	Het
Nebl	T	C	2: 17,390,926		probably benign	Het
Nebl	T	A	2: 17,393,023	Q487H	possibly damaging	Het
Nlrp2	T	A	7: 5,322,418	N14Y	possibly damaging	Het
Olfr1090	T	C	2: 86,753,887	M284V	probably benign	Het
Olfr304	T	C	7: 86,386,306	Y118C	probably damaging	Het
Olfr339	T	A	2: 36,422,287	D296E	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr992	T	A	2: 85,399,961	S191C	probably damaging	Het
Pclo	A	G	5: 14,679,797		probably benign	Het
Pld2	T	G	11: 70,554,348	N591K	probably benign	Het
Plekha7	A	G	7: 116,170,704	M276T	probably damaging	Het
Prss39	T	A	1: 34,502,200		probably benign	Het
Prtg	A	G	9: 72,809,716	Y113C	probably damaging	Het
Rab38	T	A	7: 88,450,541	I88N	probably damaging	Het
Rbfox2	A	G	15: 77,091,857		probably benign	Het
Samd5	A	G	10: 9,674,939	W9R	probably damaging	Het
Sec14l1	A	T	11: 117,156,407	K637I	possibly damaging	Het
Sh2b1	A	T	7: 126,471,448	D360E	possibly damaging	Het
Sh3bp4	A	G	1: 89,145,314	N628S	possibly damaging	Het
Sim1	A	T	10: 50,907,961	I104F	probably damaging	Het
Smcp	T	A	3: 92,584,520	T7S	unknown	Het
Sp4	A	G	12: 118,300,816		probably benign	Het
Tectb	G	T	19: 55,181,961	K81N	probably damaging	Het
Thbs4	G	T	13: 92,754,410	H850N	probably benign	Het
Tiam1	T	C	16: 89,897,754	M272V	probably benign	Het
Trav13-3	T	A	14: 53,729,776		noncoding transcript	Het
Ubap2l	A	T	3: 90,021,373	S478T	possibly damaging	Het
Vmn2r85	A	G	10: 130,419,185		probably benign	Het

Other mutations in Paxip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Paxip1	APN	5	27772552	utr 3 prime	probably benign
IGL01705:Paxip1	APN	5	27748859	missense	probably damaging	1.00
IGL01844:Paxip1	APN	5	27751038	missense	probably benign	0.17
IGL02143:Paxip1	APN	5	27775598	utr 3 prime	probably benign
IGL02863:Paxip1	APN	5	27759395	missense	probably benign	0.30
IGL02903:Paxip1	APN	5	27748872	missense	probably damaging	1.00
IGL03008:Paxip1	APN	5	27752766	missense	probably benign	0.01
BB003:Paxip1	UTSW	5	27791209	missense	unknown
BB013:Paxip1	UTSW	5	27791209	missense	unknown
R0128:Paxip1	UTSW	5	27744185	splice site	probably benign
R0331:Paxip1	UTSW	5	27765232	missense	probably damaging	0.96
R0357:Paxip1	UTSW	5	27758623	splice site	probably benign
R0370:Paxip1	UTSW	5	27760086	missense	probably damaging	1.00
R0625:Paxip1	UTSW	5	27765942	nonsense	probably null
R1969:Paxip1	UTSW	5	27744136	missense	probably damaging	1.00
R2214:Paxip1	UTSW	5	27742501	missense	probably damaging	1.00
R3424:Paxip1	UTSW	5	27775673	utr 3 prime	probably benign
R3808:Paxip1	UTSW	5	27772029	unclassified	probably benign
R3809:Paxip1	UTSW	5	27772029	unclassified	probably benign
R3881:Paxip1	UTSW	5	27748839	missense	probably damaging	1.00
R3882:Paxip1	UTSW	5	27748839	missense	probably damaging	1.00
R4685:Paxip1	UTSW	5	27761677	splice site	probably null
R4692:Paxip1	UTSW	5	27772097	unclassified	probably benign
R4776:Paxip1	UTSW	5	27765206	missense	probably damaging	1.00
R5093:Paxip1	UTSW	5	27766284	missense	unknown
R5388:Paxip1	UTSW	5	27781455	utr 3 prime	probably benign
R5397:Paxip1	UTSW	5	27772004	unclassified	probably benign
R5553:Paxip1	UTSW	5	27775639	utr 3 prime	probably benign
R6151:Paxip1	UTSW	5	27761618	missense	probably damaging	1.00
R6216:Paxip1	UTSW	5	27766173	missense	unknown
R6276:Paxip1	UTSW	5	27761668	missense	probably damaging	1.00
R6290:Paxip1	UTSW	5	27765578	splice site	probably null
R6584:Paxip1	UTSW	5	27758452	missense	probably damaging	0.98
R6688:Paxip1	UTSW	5	27744137	missense	probably benign	0.18
R6908:Paxip1	UTSW	5	27791224	missense	possibly damaging	0.90
R6981:Paxip1	UTSW	5	27765768	nonsense	probably null
R7252:Paxip1	UTSW	5	27760086	missense	probably damaging	0.96
R7385:Paxip1	UTSW	5	27781420	critical splice donor site	probably null
R7585:Paxip1	UTSW	5	27772004	missense	unknown
R7665:Paxip1	UTSW	5	27765738	missense	unknown
R7926:Paxip1	UTSW	5	27791209	missense	unknown
R8169:Paxip1	UTSW	5	27772095	missense	unknown
R8335:Paxip1	UTSW	5	27766124	missense	unknown
R8732:Paxip1	UTSW	5	27744543	missense	probably damaging	1.00
R8790:Paxip1	UTSW	5	27772080	missense	unknown
X0066:Paxip1	UTSW	5	27766018	missense	unknown
Z1176:Paxip1	UTSW	5	27783729	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGGAGACCAGAACCATGATGCC -3'
(R):5'- TGCCCAAGCCTTGCAACTATGAAG -3'

Sequencing Primer
(F):5'- AGAACCATGATGCCCCTTTTTAAC -3'
(R):5'- CGGAAGCTCATGGAGCAC -3'

Posted On

2013-06-12