Incidental Mutation 'R5529:Alpl'
ID 501083
Institutional Source Beutler Lab
Gene Symbol Alpl
Ensembl Gene ENSMUSG00000028766
Gene Name alkaline phosphatase, liver/bone/kidney
Synonyms TNSALP, TNAP, Akp-2, Akp2
MMRRC Submission 043087-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5529 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 137741733-137796384 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 137746422 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 323 (N323I)
Ref Sequence ENSEMBL: ENSMUSP00000030551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030551]
AlphaFold P09242
Predicted Effect probably damaging
Transcript: ENSMUST00000030551
AA Change: N323I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030551
Gene: ENSMUSG00000028766
AA Change: N323I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
alkPPc 52 491 4.69e-285 SMART
low complexity region 500 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141451
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is a membrane-bound glycosylated enzyme that catalyzes the hydrolysis of phosphate esters at alkaline pH. The mature peptide maintains the ratio of inorganic phosphate to inorganic pyrophosphate required for bone mineralization. Mice that lack this enzyme show symptoms of osteomalacia, softening of the bones. In humans, mutations in this gene are associated with hypophosphatasia, an inherited metabolic bone disease in which deficiency of this enzyme inhibits bone mineralization leading to skeletal defects. Mutations in the mouse gene mirror the symptoms of human hypophosphatasia. A pseudogene of this gene is present on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Males hemizygous for a null mutation exhibit reduced body size, shortened hindlimbs and tail, osteomalacia, and markedly reduced plasma phosphate levels due to impaired kidney reabsorption. Female heterozygotes exhibit milder symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Anxa3 A G 5: 96,828,379 E172G probably benign Het
Atp8a2 A G 14: 59,793,865 probably null Het
Cadps T C 14: 12,454,285 K1078E probably damaging Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Dcstamp A G 15: 39,754,536 I114V probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Fgf14 T A 14: 123,980,455 H212L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Katnb1 C T 8: 95,097,672 R495C probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Ky C T 9: 102,542,075 S427L probably benign Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr361 T A 2: 37,084,909 I280F possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Setd5 T C 6: 113,121,568 Y721H probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tbc1d8 T G 1: 39,372,755 Y1000S probably benign Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Tmem89 T C 9: 108,915,477 I146T probably damaging Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Alpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Alpl APN 4 137743313 splice site probably benign
IGL02164:Alpl APN 4 137753979 missense probably damaging 1.00
IGL02379:Alpl APN 4 137742558 missense probably damaging 1.00
IGL02632:Alpl APN 4 137753906 missense probably damaging 0.98
IGL02926:Alpl APN 4 137742634 missense probably damaging 1.00
R0492:Alpl UTSW 4 137749576 splice site probably null
R1157:Alpl UTSW 4 137754020 missense probably damaging 1.00
R2013:Alpl UTSW 4 137755147 missense probably benign 0.00
R2067:Alpl UTSW 4 137749545 unclassified probably benign
R4412:Alpl UTSW 4 137758628 missense possibly damaging 0.84
R4440:Alpl UTSW 4 137747813 missense probably damaging 1.00
R5275:Alpl UTSW 4 137749608 missense probably benign 0.00
R5295:Alpl UTSW 4 137749608 missense probably benign 0.00
R6706:Alpl UTSW 4 137746429 missense probably benign 0.00
R7291:Alpl UTSW 4 137752698 missense probably damaging 1.00
R7693:Alpl UTSW 4 137743809 missense probably damaging 1.00
R7694:Alpl UTSW 4 137743809 missense probably damaging 1.00
R8247:Alpl UTSW 4 137746453 missense probably damaging 1.00
R8686:Alpl UTSW 4 137743801 missense probably damaging 1.00
R8725:Alpl UTSW 4 137747816 missense probably benign
R8727:Alpl UTSW 4 137747816 missense probably benign
X0017:Alpl UTSW 4 137746467 missense probably damaging 1.00
Z1176:Alpl UTSW 4 137754010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGATGGCTTCTCCTCTGC -3'
(R):5'- GGGTCTTGTATCCTCTGTGACAC -3'

Sequencing Primer
(F):5'- CTCTGCCAGGAAGCCCC -3'
(R):5'- GTATCCTCTGTGACACCCTGGG -3'
Posted On 2017-12-01