Incidental Mutation 'R5529:Setd5'
ID501084
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene NameSET domain containing 5
Synonyms2900045N06Rik
MMRRC Submission 043087-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5529 (G1)
Quality Score216
Status Not validated
Chromosome6
Chromosomal Location113077365-113153435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113121568 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 721 (Y721H)
Ref Sequence ENSEMBL: ENSMUSP00000108782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
Predicted Effect probably damaging
Transcript: ENSMUST00000042889
AA Change: Y702H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: Y702H

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113155
AA Change: Y721H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: Y721H

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113157
AA Change: Y721H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: Y721H

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142215
AA Change: Y779H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153513
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Alpl T A 4: 137,746,422 N323I probably damaging Het
Anxa3 A G 5: 96,828,379 E172G probably benign Het
Atp8a2 A G 14: 59,793,865 probably null Het
Cadps T C 14: 12,454,285 K1078E probably damaging Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Dcstamp A G 15: 39,754,536 I114V probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Fgf14 T A 14: 123,980,455 H212L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Katnb1 C T 8: 95,097,672 R495C probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Ky C T 9: 102,542,075 S427L probably benign Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr361 T A 2: 37,084,909 I280F possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tbc1d8 T G 1: 39,372,755 Y1000S probably benign Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Tmem89 T C 9: 108,915,477 I146T probably damaging Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
R7515:Setd5 UTSW 6 113110889 missense probably damaging 1.00
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGAAGCTGAAACCATCC -3'
(R):5'- CCAAAGCGAATGTAGTGTTTGG -3'

Sequencing Primer
(F):5'- ATCTGTCTTTGTGAGCATGGAAAATG -3'
(R):5'- TGGGGGTGGTACAAATTAATGG -3'
Posted On2017-12-01