Incidental Mutation 'R5474:Dgkq'
ID501098
Institutional Source Beutler Lab
Gene Symbol Dgkq
Ensembl Gene ENSMUSG00000004815
Gene Namediacylglycerol kinase, theta
Synonyms110kDa, DAGK7, Dagk4, Dgkd, Dgk theta
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5474 (G1)
Quality Score214
Status Not validated
Chromosome5
Chromosomal Location108646693-108669672 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 108649143 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053913] [ENSMUST00000053913] [ENSMUST00000053913] [ENSMUST00000063272] [ENSMUST00000078323] [ENSMUST00000120327] [ENSMUST00000132179] [ENSMUST00000132708] [ENSMUST00000153238]
Predicted Effect probably null
Transcript: ENSMUST00000053913
SMART Domains Protein: ENSMUSP00000057859
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
C1 114 162 1.73e-2 SMART
C1 178 228 1.58e-13 SMART
low complexity region 267 275 N/A INTRINSIC
RA 387 486 2.08e-20 SMART
DAGKc 580 707 4.79e-63 SMART
DAGKa 733 885 7e-88 SMART
Predicted Effect probably null
Transcript: ENSMUST00000053913
SMART Domains Protein: ENSMUSP00000057859
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
C1 114 162 1.73e-2 SMART
C1 178 228 1.58e-13 SMART
low complexity region 267 275 N/A INTRINSIC
RA 387 486 2.08e-20 SMART
DAGKc 580 707 4.79e-63 SMART
DAGKa 733 885 7e-88 SMART
Predicted Effect probably null
Transcript: ENSMUST00000053913
SMART Domains Protein: ENSMUSP00000057859
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
C1 114 162 1.73e-2 SMART
C1 178 228 1.58e-13 SMART
low complexity region 267 275 N/A INTRINSIC
RA 387 486 2.08e-20 SMART
DAGKc 580 707 4.79e-63 SMART
DAGKa 733 885 7e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063272
SMART Domains Protein: ENSMUSP00000068607
Gene: ENSMUSG00000013495

DomainStartEndE-ValueType
Pfam:DUF1211 31 121 7.3e-28 PFAM
transmembrane domain 135 157 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
Pfam:DUF1211 256 353 4.4e-36 PFAM
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078323
SMART Domains Protein: ENSMUSP00000077437
Gene: ENSMUSG00000013495

DomainStartEndE-ValueType
Pfam:DUF1211 31 121 7.3e-28 PFAM
transmembrane domain 135 157 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
Pfam:DUF1211 256 353 4.4e-36 PFAM
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120327
SMART Domains Protein: ENSMUSP00000112780
Gene: ENSMUSG00000013495

DomainStartEndE-ValueType
Pfam:DUF1211 32 121 1.5e-22 PFAM
transmembrane domain 135 157 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
Pfam:DUF1211 257 353 9.5e-27 PFAM
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123669
Predicted Effect probably benign
Transcript: ENSMUST00000132179
SMART Domains Protein: ENSMUSP00000118466
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145917
Predicted Effect probably benign
Transcript: ENSMUST00000153238
SMART Domains Protein: ENSMUSP00000118065
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198346
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains three cysteine-rich domains, a proline-rich region, and a pleckstrin homology domain with an overlapping Ras-associating domain. It is localized in the speckle domains of the nucleus, and mediates the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Dgkq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dgkq APN 5 108654582 missense possibly damaging 0.72
IGL02364:Dgkq APN 5 108656444 missense probably benign 0.05
IGL02966:Dgkq APN 5 108656421 splice site probably null
IGL03297:Dgkq APN 5 108650274 missense probably damaging 1.00
R0179:Dgkq UTSW 5 108658200 splice site probably benign
R0194:Dgkq UTSW 5 108654644 intron probably benign
R0332:Dgkq UTSW 5 108655099 splice site probably benign
R0513:Dgkq UTSW 5 108656495 missense probably benign 0.02
R0525:Dgkq UTSW 5 108654615 missense probably damaging 1.00
R0673:Dgkq UTSW 5 108655589 missense probably damaging 0.97
R0801:Dgkq UTSW 5 108660720 splice site probably null
R0850:Dgkq UTSW 5 108654578 missense possibly damaging 0.82
R0944:Dgkq UTSW 5 108656465 missense probably damaging 1.00
R1069:Dgkq UTSW 5 108656037 splice site probably benign
R1411:Dgkq UTSW 5 108650362 missense probably damaging 1.00
R1488:Dgkq UTSW 5 108650877 missense probably damaging 1.00
R1858:Dgkq UTSW 5 108653731 missense probably benign 0.00
R1874:Dgkq UTSW 5 108660595 missense probably benign 0.07
R2210:Dgkq UTSW 5 108660523 missense probably damaging 1.00
R4499:Dgkq UTSW 5 108649661 missense possibly damaging 0.54
R5061:Dgkq UTSW 5 108654123 missense probably benign 0.02
R5481:Dgkq UTSW 5 108648810 splice site probably null
R5951:Dgkq UTSW 5 108654370 missense probably damaging 1.00
R6193:Dgkq UTSW 5 108655500 nonsense probably null
R6429:Dgkq UTSW 5 108653708 missense probably damaging 1.00
R6458:Dgkq UTSW 5 108654376 missense possibly damaging 0.93
R7388:Dgkq UTSW 5 108658246 missense probably damaging 0.99
R7398:Dgkq UTSW 5 108655190 missense possibly damaging 0.90
R8098:Dgkq UTSW 5 108652468 missense probably damaging 1.00
R8244:Dgkq UTSW 5 108648712 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGGTTCCACTCCACAAAAGAG -3'
(R):5'- TTTTGTCTTACCCAGGGCCAG -3'

Sequencing Primer
(F):5'- ACCTAGAAAAGCTGTCTAGTAGC -3'
(R):5'- TTACCCAGGGCCAGGTACAAG -3'
Posted On2017-12-01